1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
morpeh [17]
3 years ago
15

What is change in species over time

Biology
1 answer:
Tresset [83]3 years ago
4 0
Evolution is change over time.
You might be interested in
What are the two factors that influence gravity? 1)Speed and distance. 2)Color and shape 3)Neight and shape. 4) Nass and distanc
Gwar [14]
I believe it’s either 1 or 4
7 0
3 years ago
Where do cells store the energy of carbohydrates?
Assoli18 [71]
<span>Your body stores energy as glycogen in muscle tissue and the liver. This glycogen is stored glucose(a carbohydrate).</span>
4 0
3 years ago
Which types of bacteria does the Monera Kingdom consist of ?
nlexa [21]

Answer:

Prokaryotic Bacteria

5 0
3 years ago
Read 2 more answers
Question 6 You cross a true-breeding red-flowered snapdragon with a true-breeding white-flowered one. All of the FI are pink. Wh
muminat

Answer:

E (Red shows incomplete dominance over white)

Explanation:

This portrays a monohybrid cross involving a single gene coding for flower colour in snapdragon plants. According to the question, a purebreeding red flowered (homozygous) plant is crossed with a purebreeding white flowered (homozygous) plant to produce an all pink flowered offspring. This phenomenon is called INCOMPLETE DOMINANCE.

Mendel, in his experiments, discovered that an allele can mask the expression of another in a heterozygous state. He called the allele that masks DOMINANT allele while the allele that is masked RECESSIVE allele. However, exceptions like INCOMPLETE DOMINANCE, has occurred in the sense that an allele does not completely mask the expression of its allelic pair, instead an intermediate phenotype, which is a combination/blending of both parental phenotypes is produced.

In this case, the red flowered snapdragon (RR) does not completely cover up the expression of white flower (rr), hence a hybrid/heterozygous offspring is produced that combines the phenotypic characteristics of both parents to form an intermediate flower colour (pink). Hence, it can be said that Red flower is incompletely dominant over white flower or no allele/trait is dominant or recessive to another.

3 0
3 years ago
Arteries are blood vessels that transport oxygen-rich blood and nutrients throughout the body. What level of organization is an
Contact [7]

Answer:C

Explanation:

The arteries are not a cell bc that is too simple a tissue is also too simple its not a system bc arteries are not a lot of organs working together so its C

5 0
3 years ago
Other questions:
  • A new father tells the nurse that he is anxious about not feeling like a father. what is the priority nursing action to meet thi
    13·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Water is less ________ at lower temperatures because hydrogen bonds are more _________ and bond to each of its neighbors.
    10·1 answer
  • 10 points!!!!!!!!!PLZ HELP ASAP;;Think about how the amount of energy changes as you move stepwise from producers to primary con
    6·2 answers
  • Nucleic acids - dna or rna. chemically, they are similar. structurally, there are differences. which formula represents dna?
    14·1 answer
  • The mohs scale measures a mineral’s _____. a. luster b. structure c. density d. hardness
    14·2 answers
  • What uses chemicals to develop gunpowder residue patterns particularly around bullet holes
    14·2 answers
  • The type of tectonic plate boundary that occurs when two plates are colliding into each other is known as a ____.
    12·1 answer
  • What is the effect of the presence of double bonds in plant lipids?
    9·1 answer
  • If i need 3/4 cup of oats for a batch of muffins how much muffins can i make with 1 1/2 cups of oats
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!