1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nookie1986 [14]
3 years ago
7

Based on your observations, how many cells are in anaphase? A.14 B.41 C.10 D.19

Biology
1 answer:
irina1246 [14]3 years ago
5 0

Answer:

D

Explanation:

I think there are 19.

You might be interested in
Naturally occurring methods of recombining DNA within a species to increase variation include all BUT
WITCHER [35]
My Answer: DNA cloning.

Hope I helped! :D
7 0
3 years ago
Read 2 more answers
Which pair shares the same function?
kirza4 [7]

the answer is b

Explanation:

8 0
3 years ago
.
aev [14]
The second one is the answer
6 0
3 years ago
In the Kirby-Bauer disk diffusion test, the _______ of the zone of inhibition is measured and used for interpretation.
snow_tiger [21]

Answer:

The correct option is : a. diameter    

Explanation:

The Kirby–Bauer test or the disk diffusion test, is a method to determine the antibiotic sensitivity of the given bacteria. This test involves the use of antibiotic discs to determine the effect of antibiotics on the bacteria.

In this test, the wafers having antibiotics and the bacteria are placed on the agar plate and incubated. If the antibiotics present stops the growth of the bacteria, there will be an area around wafer with no bacterial growth, such an area is known as the zone of inhibition.

<u>The </u><u>diameter of this zone of inhibition</u><u> is measured to determine the </u><u>antibiotic sensitivity of the given bacteria</u><u>.</u>

7 0
3 years ago
The maximum number of individuals of a population that can be sustained indefinitely
denis-greek [22]

Answer:

Carrying Capacity  

Explanation:

5 0
3 years ago
Other questions:
  • In a comparison of the stages of meiosis to the stages of mitosis, which stages are unique to meiosis and which stages have the
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which piece of children’s playground equipment could be used to model and explain the movement of matter in the biosphere?
    7·1 answer
  • What is a pterophytes.
    13·2 answers
  • Nausea and vomiting are common complaints during pregnancy. what nutritional action can be used to lessen nausea and vomiting?
    6·1 answer
  • Wich is true of hydroxide ions
    6·2 answers
  • In order to determine if mutations from different organisms that exhibit the same phenotype are allelic, which test would you pe
    8·1 answer
  • 30 points --
    5·1 answer
  • An Rh+ mother should be concerned if she is pregnant with an Rh- baby. True or False
    9·1 answer
  • what would be he the strand of complementary DNA produced be the strand of DNA shown below&gt; TCG AAG
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!