1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorC [24]
3 years ago
7

A researcher has sequenced a gene that has two alleles. she has a mixture of both alleles and clones them into

Biology
2 answers:
netineya [11]3 years ago
7 0

The blue-white screen refers to a procedure of screening that allows for the brisk and convenient determination of recombinant bacteria in vector-based molecular cloning experiments. In the process, the DNA of interest is ligated into a vector. The blue colonies constitute of self-relegated plasmids that are devoid of DNA inserts obstructing the lac Z gene.  

The white colonies contain bacteria that conduct plasmids, which possess the inserts of DNA fragments that obstruct the lac Z gene. Therefore, the researcher needs to sequence the plasmids of the white colonies prior to knowing which allele it constitutes.  


alisha [4.7K]3 years ago
5 0

The researcher can identify colonies containing disease-causing alleles by performing a blue-white screen technique.

Further Explanation:

A technique through which convenient and rapid detection of recombinant bacteria or genes by using molecular cloning experiments that are based on vectors is called a blue-white screen. In this technique, <u>a DNA or allele to be sequenced is inserted into a vector, which is then incorporated into a host cell or E. coli where transformation can take place. </u>These cells then grow in the presence of X-gal. <u>The cells containing the transformed vector with the recombinant DNA will result in white colonies, while the transformed cells</u> containing only the vector will produce blue colonies. The white colonies are the ones containing the gene of interest and can be further selected for sequencing.

In the lac operon, the lacZ gene is responsible for the production of a protein called β-galactosidase. <u>This protein, when present in its active state, exists in the form of a homotetramer. </u>A mutant β-galactosidase lacks certain N-terminal residues and is called ω-peptide, which is not capable of forming a tetramer; therefore, it is inactive. <u>This mutant protein can get back to its active form when the N-terminal containing fragment called α-peptide is present. </u>The restoration of the mutant β-galactosidase function through α-peptide is known as α-complementation.

While performing the screening method, the plasmid contains the α-peptide within which multiple cloning sites (MCS) are present and the E. coli contains the ω-peptide. <u>These MCS can be inserted with a foreign gene through </u><u>restriction enzyme.</u><u> </u>This, in turn, disrupts the functionality of the α-peptide or lacZα gene. As a result, the cells comprising the plasmid with the gene of interest does not produce functional β-galactosidase.

Here, when the scientist ligates the plasmid with the specific allele, the lacZα gene becomes non-functional. <u>On insertion of the recombinant plasmid into the E. coli, β-galactosidase is not formed, and no blue colored colonies are produced. </u>Therefore, the cells producing white colonies contain the gene of interest and can be selected for further sequencing.

Learn More:

  1. Learn more about the fibrous skeleton of the heart <u>brainly.com/question/7301375 </u>
  2. Learn more about blood cells bring oxygen and take carbon dioxide away <u>brainly.com/question/1213217 </u>
  3. Learn more about the system prepares food for absorption into the bloodstream <u>brainly.com/question/310282 </u>

Answer Details:

Grade: College Biology

Chapter: Isolation and Analysing Genes

Subject: Biology

Keywords:

Blue-white screen, DNA, genes, alleles, β-galactosidase, α-peptide, ω –peptide, lacZα gene, multiple cloning sites, plasmid, vector, E. coli, transformation, recombinant, non-recombinant, blue colonies, white colonies.

You might be interested in
What do echinoderms have instead of brains?
Ludmilka [50]

Answer:

Instead of a brain, echinoderms have a ring of nerves located around their mouth area that governs their nervous responses. This ring coordinates their motion, their eating, basically anything that requires nerve control.

Explanation:

3 0
3 years ago
The two upper chambers of the heart are separated from each other by the
lisabon 2012 [21]
 lungs or ribs that separate the two upper chambers from each other
8 0
3 years ago
Read 2 more answers
Adenine always pairs with ?
padilas [110]
It pairs with Thymine
8 0
3 years ago
Read 2 more answers
.. Which of the following mutations would have the potential to affect future generations of
ch4aika [34]

Answer choices:

  • A frame shift mutation in the X chromosome of a cheek cell
  • A chromosomal mutation in the Y chromosome of a kidney cell
  • A point mutation in the first chromosome of a sperm cell
  • A substitution mutation in the third chromosome of a uterus cell

Answers:

A point mutation in the first chromosome of a sperm cell

Explanation:

Only mutations that affect the germ line are passed on to the next generation. Therefore, only mutations in the egg and sperm of an individual have the potential to affect the next generation.

Mutations in cheek cells, kidney cells, and uterus cells might cause cell death or cancer. This genetic material is not passed on to the next generation, only the egg and sperm contribute this material. Therefore, only mutations here will affect the generation.

4 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Other questions:
  • Anywhere the skin is touched in that area stimulates that ____________ neuron.
    5·1 answer
  • What does agglutination mean in blood typing?
    13·1 answer
  • Which feature helps shortleaf pines resist fires
    7·2 answers
  • Which best describes the blood flowing in a vein?
    7·2 answers
  • Which layer of the sun is shown extending into space in the picture above?
    12·2 answers
  • Which word from the press release addresses Marquez's wide range of writing?
    13·2 answers
  • What is osmoregulation?
    12·2 answers
  • Large teeth is a dominant trait in piranhas. Which of the following shows the
    15·1 answer
  • How many chromosomes do humans have inside our nucleus?
    13·1 answer
  • The principle of competitive exclusion states that A. two species cannot coexist in the same habitat. B. competition between two
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!