1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Readme [11.4K]
3 years ago
5

Which best describes the purpose of the European Union?

Biology
1 answer:
Alexxandr [17]3 years ago
4 0
"To help foster peace and economic collaboration among European nations" is the one among the following choices given in the question that <span>best describes the purpose of the European Union. The correct option among all the options that are given in the question is the first option or option "A". </span>
You might be interested in
Respiration involves the breakdown of sugar. This process results in the production of energy for the cell. In order for cells t
riadik2000 [5.3K]
The answer is oxygen.
8 0
3 years ago
Read 2 more answers
Why is biodiversity important in the urban setting? what does it tell you about the environment?
Aleks [24]
It is important<span> to distinguish between species richness and </span>biodiversity<span>. ... Species richness enhanced by exotics also often means the loss of distinctive ecosystems or small azonal habitat </span>areas<span> such as localised wetlands. This too represents a loss in overall global </span>biodiversity<span>.;0</span>
4 0
2 years ago
This model shows a human embryo. What can you determine about its development from the model?
sasho [114]

Answer:

It has a postanal tail.

It has pharyngeal arches.

5 0
3 years ago
Define and give examples of greenhouse gases
valentinak56 [21]

Answer:

'a gas that contributes to the greenhouse effect by absorbing infrared radiation, e.g., carbon dioxide and chlorofluorocarbons.' examples of greenhouse gases is

5 0
2 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • A change that increases an organism's chances of survival is called a(n) _____.
    7·1 answer
  • How should you test a hypothesis?
    15·1 answer
  • Which of the following is UNTRUE about cilia? A. They are used to sweep food into mouth-like openings. B. They are used to form
    15·2 answers
  • When a doctor needs to give someone a medication intravenously (through a vein), they dilute that medicine in a saline solution
    8·1 answer
  • Choose the correct order of steps for the synthesis of Vitamin D.
    10·1 answer
  • Electromagnetic waves differ in
    13·1 answer
  • Amino acid catabolism involves the breakdown of 20 amino acids all of which contain nitrogen but have different carbon skeletons
    5·1 answer
  • HELP........................................
    7·2 answers
  • When fat comes in contact with sodium hydroxide it produces soap and glycerin. Determine wheather this is a physical change or a
    15·1 answer
  • Which of the following is least likely to have difficulties with economic access to potable water? a. Zimbabwe b. Australia c. I
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!