First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
The three gases that are part of Earth’s cycles in both the atmosphere and biosphere are:
- oxygen
- - nitrogen
- - carbon dioxide
<h3>Explain your answer?</h3>
The oxygen, nitrogen, and carbon dioxide are the three gasses that are constantly moving through the atmosphere and biosphere in their own respective cycles.
The oxygen is used by the animals for breathing, but it is also released as a byproduct by the producers. The nitrogen is used as a food source for the producers, as well as the carbon dioxide which is crucial for the process of photosynthesis.
Thus, Part of them is released through decomposition, part by releasing them in the atmosphere or in the soil.
To learn more about gases click here:
brainly.com/question/1369730
#SPJ1
It makes photosynthesis<span> more efficient.</span>
DNA fingerprinting is far more conclusive because it is solid proof. It has evidence that a certain person was at a certain place at a particular time frame. Although most criminals do get asked to use the polygraph test, testing guilt I guess, measures only their heart rate. Which in a normal view many regular people would be nervous. There has been countless reports where murders can pass a polygraph test, but then be convicted of a crime due to proof of evidence from fingerprints. Humans are emotional beings, some can crack easily while some won't (through interrogation). So that's why it's key investigations use science to back up their crimes rather that try to measure someone's guilt.
I hope this answered your question!
Answer: Photoelectron spectroscopy is the energy measurements of photoelectrons emitted from solids, gases, or liquids by the photoelectric effect. Depending on the source of ionization energy, it can be divided accordingly into Ultraviolet Photoelectron Spectroscopy and X-ray Photoelectron Spectroscopy.
Explanation: