1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BARSIC [14]
3 years ago
12

Consider a plant that grows best in bright sunlight in which seed germination is controlled by phytochromes. Which of the follow

ing statements describe(s) the structure and function of phytochromes in this plant? a. When a phytochrome in the Pfr configuration absorbs far-red light, the phytochrome reverts to the Pr configuration. b. Far-red light stimulates the plant seeds to germinate when the phytochrome is in the Pfr configuration. c. The plant seeds are more likely to germinate after exposure to red light than after exposure to far-red light. d. The effects of red and far-red light on phytochromes are irreversible. e. Phytochromes absorb red light and far-red light equally when the phytochrome is in the Pfr configuration. f. Phytochromes absorb red light maximally when the phytochrome is in the Pr configuration. g. Phytochromes contain photoreceptors.
Biology
1 answer:
ddd [48]3 years ago
3 0

Answer:

The answer is c) The plant seeds are more likely to germinate after exposure to red light than after exposure to far-red light

Explanation:

Phytochromes are involved in the biological cycle of the plant, from germination to flowering and tubing. The red light (660 nm) activates the phytochrome, while the ultra-red or far red light (730 nm) inactivates it. In both positive photoblastic seeds (response of the seeds to light) and in the negative photoblastic seeds the red light stimulates germination, while the distant red light inhibits it.

You might be interested in
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′
Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0
4 years ago
Which correctly lists the three gases that are part of Earth’s cycles in both the atmosphere and biosphere? radon, carbon monoxi
serg [7]

The three gases that are part of Earth’s cycles in both the atmosphere and biosphere are:

  • oxygen
  • - nitrogen
  • - carbon dioxide

<h3>Explain your answer?</h3>

The oxygen,  nitrogen, and carbon dioxide are the three gasses that are constantly moving through the atmosphere and biosphere in their own respective cycles.

The oxygen is used by the animals for breathing, but it is also released as a byproduct by the producers. The nitrogen is used as a food source for the producers, as well as the carbon dioxide which is crucial for the process of photosynthesis.

Thus, Part of them is released through decomposition, part by releasing them in the atmosphere or in the soil.

To learn more about gases click here:

brainly.com/question/1369730

#SPJ1

8 0
2 years ago
How does having many small chloroplasts rather than one large one within each cell benefit a plant?
TiliK225 [7]
It makes photosynthesis<span> more efficient.</span>
3 0
3 years ago
Read 2 more answers
Why is DNA fingerprinting more conclusive when proving a person’s innocence rather than their guilt?
Likurg_2 [28]
DNA fingerprinting is far more conclusive because it is solid proof. It has evidence that a certain person was at a certain place at a particular time frame. Although most criminals do get asked to use the polygraph test, testing guilt I guess, measures only their heart rate. Which in a normal view many regular people would be nervous. There has been countless reports where murders can pass a polygraph test, but then be convicted of a crime due to proof of evidence from fingerprints. Humans are emotional beings, some can crack easily while some won't (through interrogation). So that's why it's key investigations use science to back up their crimes rather that try to measure someone's guilt.

I hope this answered your question!
6 0
3 years ago
Read 2 more answers
How are photoelectron spectroscopy and the photoelectric effect related
earnstyle [38]

Answer: Photoelectron spectroscopy is the energy measurements of photoelectrons emitted from solids, gases, or liquids by the photoelectric effect. Depending on the source of ionization energy, it can be divided accordingly into Ultraviolet Photoelectron Spectroscopy and X-ray Photoelectron Spectroscopy.

Explanation:

4 0
3 years ago
Other questions:
  • Because bamboo can be harvested and regrown quickly it is what type of resource
    10·1 answer
  • Which of the following representations shows how one variable changes in response to another variable?
    13·1 answer
  • What are three heat sources for metamorphism?
    5·2 answers
  • “!PLEASE HELP!” (8 POINTS)
    8·2 answers
  • Why are cells generally so small? Select all of the answers that apply.
    7·1 answer
  • There are many traits for which it seems natural selection should favor an increase every generation, such as survival from birt
    14·1 answer
  • Can a plant grow better in dirt or soil
    13·2 answers
  • Which of the following processes is most responsible for producing the landscape of Florida’s beaches
    12·1 answer
  • What is the purpose of inserting a target gene into bacteria?
    12·1 answer
  • If water were a nonpolar molecule, how would its properties be different?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!