1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
12

You examine an unknown cell under the microscope and discover that the cell

Biology
1 answer:
igor_vitrenko [27]3 years ago
3 0

Answer:

plants or blue-green algae

Explanation:

The plants cells have chloroplasts that contain chlorophyll. When the cells are stained and observed under the microscope, chloroplast is seen. Chloroplast is only present in photosynthetic organisms. The chloroplast traps light that is used during photosynthesis.

You might be interested in
Living organisms are only able to function and thrive if they can maintain constant or stable internal conditions. This ability
Hatshy [7]
The ability of organisms to regulate and thus maintain a relatively stable internal environment, despite external pressures, is called HOMEOSTASIS. This word comes from two Latin/Greek root words: "homeo" and "stasis".
"Homeo" means constant or unchanging. And "stasis" or "static" refers to stillness, non-movement. So, together, we can translate Homeostasis into a constant stillness inside, which makes sense for "maintaining normal internal states."
8 0
3 years ago
Read 2 more answers
What is water’s role in the light reaction of photosynthesis?
notsponge [240]

The correct answer is - Its electrons are used to form NADPH.

On receiving light energy, electrons are expelled from the reaction center of photosystem II. The expelled electrons finally reduces oxidized NADH⁺ to NADH. The oxidized reaction center of photosystem II split water into protons, electrons and oxygen. The electrons released from water reduces oxidized reaction center of photosystem II. Thus, oxidized reaction center of photosystem II gets back its expelled electrons. Therefore, electrons from water forms NADH.

8 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
The genetic change in a population or species over many generations is _____.
Over [174]
The genetic change in a population or species over many generations is evolution. Whether it be physical or mental increase.
8 0
3 years ago
Read 2 more answers
Fault lines are:
JulsSmile [24]
The answer is C
Why ?
The definition of the biosphere: i<span>s the global ecological system integrating all living beings and their relationships, including their interaction with the elements of the lithosphere, geosphere, hydrosphere, and atmosphere.</span><span>A example of a fault line would be the san Andreas fault line .</span><span>
</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is a organic molecule
    12·2 answers
  • Clostridium botulinum is a bacterium that produces botulinum toxin that inhibits the release of acetylcholine. Which description
    5·2 answers
  • Human respiration is a chemical process that results in the release of energy. In this process, organic compounds transform into
    10·1 answer
  • Based on the images taken through Stella’s microscope, which cell structures could be clearly identified using a compound micros
    11·1 answer
  • I need extreme help!!1 I'm doing an essay in biology that is only 5 sentences long. I'll leave my teacher's example. The questio
    8·1 answer
  • What is the probability of flipping a coin twice and getting two heads?
    8·1 answer
  • 19. How would the rock cycle be affected in an area where tectonic plate motion is increasing the height and steepness of a moun
    11·1 answer
  • Help plsss important
    5·2 answers
  • What is soil erosion ??​
    11·2 answers
  • Why it is important to place the gel in the correct direction in the gel cassette while running it?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!