1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GREYUIT [131]
4 years ago
13

Which letter on the diagram below represents the lens of the eye?

Biology
2 answers:
eduard4 years ago
8 0

Answer:

B

Explanation:

Orlov [11]4 years ago
8 0

Answer:

B

Explanation:

lens is in the middle of the eye.

hope it helps

You might be interested in
Mary had a baby last year. She is normally very healthy, but has been experiencing some embarrassing symptoms.
oksian1 [2.3K]
It is most likely because Mary’s body went through changes. And from 6 months to a year after pregnancy these “embarrassing symptoms can persist. There can be hormonal changes and cause the body to do abnormal things.

I hope this helps.
7 0
3 years ago
How would you use mutaulism in a sentence?
Ymorist [56]
 mutualism is a mutual relationship such as co-ownership of property where both parties benefit.

<span>

</span>
6 0
3 years ago
Organic phosphate is taken up by producers during photosynthesis and released by cellular respiration.
Zina [86]

Answer:

true

Explanation:

pa brainliest po please

<u><em>#carryonlearning</em></u>

4 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
What is the species name of a cat?
NISA [10]

Answer: Scientific name: Felis catus.

Explanation: I hope this helps :p

7 0
3 years ago
Read 2 more answers
Other questions:
  • How does the paradise flycatcher protect its young from predators? It wraps its wings around its chicks. It puffs out its feathe
    6·2 answers
  • Name three desirable traits that are being transferred into genetically engineered food crops how might these traits helped incr
    7·1 answer
  • Bermuda grass has _____, or stems that grow along the ground and produce roots, stems, and leaves. 1. stolons 2. tubers 3. rhizo
    11·2 answers
  • Why is it not totally surprising that animals can suffer from emotional distress or mental illness?
    7·1 answer
  • New traits and variations in a population occur by
    10·1 answer
  • Which best describes the process of conduction?
    10·1 answer
  • Explain how the abiotic factors in an environment have a huge impact on the biotic factors living in an environment.
    5·1 answer
  • How is energy related to the change of state
    14·1 answer
  • The cell cycle has a regular system of checks and balances that prevents damaged or mutated cells from proceeding to the next ph
    10·1 answer
  • If a cell is in a hypertonic solution, which statement is true about water movement and the cell?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!