1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kicyunya [14]
3 years ago
10

Correctly describe pH of a solution?

Biology
2 answers:
UkoKoshka [18]3 years ago
8 0

Answer:

The pH value of a solution reflects the relative concentration of hydrogen ions (H+) or protons to the concentration of hydroxide ions (OH-) in a solution. Solutions with a pH value less than 7 are acidic and those with a value greater than 7 are basic, or alkaline.

Explanation:

Read in article. Sorry if I'm wrong.

MaRussiya [10]3 years ago
8 0
The pH of a solution is a measure of the molar concentration of hydrogen ions in the solution and as such is a measure of acidity or basicity of the solution. the letters PH stand for“power of hydrogen”and the numeral value is defined as the negative base 10 logarithm of the molar concentration of hydrogen ions.
You might be interested in
1.) How do photosynthesis and cellular respiration relate to each other?
lyudmila [28]
1.) the products of photosynthesis are the reactants and the other way around too
2.) cellular respiration turns glucose (or food) into energy the cell can use (ATP) almost all eukaryotes do this
3.) to convert energy from the sun (with other things) into energy (glucose)

this has to be broken down to be used but all things get their energy from the sun, producers get it directly, then primary consumers eat the producers, then secondary,and tertiary
but it is all comes from the sun originally
4 0
3 years ago
What is a disadvantage of the point count of monitoring of population monitoring
vodka [1.7K]

The answer is 116.

 

112+120=232

232/2= 116

8 0
3 years ago
One of the most fundamental differences in hinduism is the split between viewpoints that are monistic and
torisob [31]
Hinduism is known to be both monistic and <span>polytheistic </span>
3 0
3 years ago
Under what conditions is a rock more likely to deform plastically than<br> to break?
Likurg_2 [28]

At the Earth's surface, rocks usually break quite quickly, but deeper in the crust, where temperatures and pressures are higher, rocks are more likely to deform plastically. Sudden stress, such as a hit with a hammer, is more likely to make a rock break. Stress applied over time often leads to plastic deformation. Hope this helps. ヅ

5 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • - Which of the following is an interaction in which<br> both organisms are harmed
    11·2 answers
  • Germination
    6·1 answer
  • PLEASE HELP!!
    9·2 answers
  • Information based on opinions is valid. Please select the best answer from the choices provided T or
    13·1 answer
  • Question 7
    5·1 answer
  • What type of limiting factor is space
    12·1 answer
  • I need help with physiology, how the brain perceived visual information? Fill in the blank
    11·1 answer
  • I have 5 questions i need help on please help
    15·1 answer
  • How would you describe the relationship between the two variables?
    13·1 answer
  • It is biology ?!!iiii
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!