1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pavlova-9 [17]
3 years ago
14

How does the heart work with other systems to keep the body healthy?

Biology
1 answer:
valentina_108 [34]3 years ago
4 0
The heart<span> is at the centre of your circulatory </span>system, which is a network of blood vessels that delivers blood to every part of your body. Blood carries oxygen and other important nutrients that all body organs need to stay healthy and to work properly. In other words, it supplies oxygen and nutrients to our bodies by working with the respiratory system<span>. At the same time, the </span>circulatory system<span> helps carry waste and carbon dioxide out of the body. Hormones — produced by the endocrine </span>system<span> — are also transported through the blood in the </span>circulatory system<span>.

Hope this helps xox</span>
You might be interested in
What is the first thing to occur in dna replication?
12345 [234]
The first thing is that the enzyme, DNA helicase
breaks the hydrogen bonds to unzip the double strand of dna for replication to take place
4 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
In the F2 generation of Mendel’s crosses,
Oksi-84 [34.3K]

Next, Mendel took the F1 progeny and allowed them to self-fertilize. In the resulting F2 generation, 3/4 showed the dominant phenotype, and 1/4 showed the recessive phenotype. ... 1 out of 3 round pea plants from the F2 generation were true-breeding and produced only offspring with round peas.

8 0
3 years ago
Read 2 more answers
How do baroreceptor reflexes would respond to a fall in blood pressure?
RoseWind [281]

Answer:

Barroreceptors are specific type of receptors that are present within the membrane or wells of the blood vessels and monitor the changes occur in blood pressure.

The major and important barroreceptors are located in carotid sinus and the aorta for detecting fluctuation in the blood pressure. If blood pressure falls these receptors firing rate decreases and barroceptors reflexes act to increase heart rate in order to restore blood pressure in an individual.

Thus, the correct answer would be - increasing heart rate.

3 0
3 years ago
Which most likely happen to the population of deer in 1963
Stels [109]

The correct answer choice should be B.) The population exceeded past its carrying capacity. Hope this helped!

7 0
3 years ago
Read 2 more answers
Other questions:
  • Organisms that feed on dead decaying matter are called?
    8·1 answer
  • Peanuts, flax, sunflowers, safflower and cotton are all grown for their_______. (Sugar, vitamins, amino acid, carbohydrate, oil)
    12·1 answer
  • Which of the following best pairs Darwin's contributor to his ideas?
    14·1 answer
  • List and briefly describe four components of innate immunity (include one barrier defense and three internal defenses)
    5·1 answer
  • Mark is participating in one of Posner's attention experiments. As he looks at the fixation point, an arrow pointing to the righ
    14·1 answer
  • The Waldorf family was caught in a fire but escaped. Unfortunately, the father and daughter suffered burns. The father had secon
    6·1 answer
  • What is the genotype and phenotype for A male hemophiliac with a woman pure for normal clotting.
    15·1 answer
  • When one magnesium atom and two chlorine atoms transfer electrons, magnesium loses two electrons, and each chlorine gains
    15·1 answer
  • Which immune cells directly mediate the apoptosis of the kidney cells and therefore the rejection of the kidney itself
    7·1 answer
  • shen l, jhund ps, petrie mc, claggett bl, barlera s, cleland jgf, dargie hj, granger cb, kjekshus j, køber l, et al.. declining
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!