1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andriy [413]
4 years ago
5

The cleavage of glycogen by glycogen phosphorylase releases _____.

Biology
1 answer:
andreev551 [17]4 years ago
8 0
Answer: Glucose

Explanation: Glycogen is a polysaccharide, composed of glucose monomers.
You might be interested in
How does the table indicate that a cat is more closely related to a bobcat than a ferret
ira [324]
Unfortunately this question is incomplete as the table is not visible. The table can be viewed here: <span> <span><span> <span> https://www.slideshare.net/smullen57/53-classification-and-biodiversitydoc
<span> <span><span> <span> <span> <span><span> <span> All three species share the same taxonomy down to the level of Order: Kingdom Animalia, Phylum Chordata, Class, Mammalia, Order Carnivora.The ferret is in a different family: Mustelidae whereas both the bobcat and domestic cat are in the same family: Felidae and Genus: Felis. Therefore, the bobcat and domestic cat are more related by two branches in the taxonomic hierarchy.</span></span></span></span></span></span><span><span> </span> </span> </span></span></span></span><span> </span> </span></span>
6 0
3 years ago
How many chambers in a frog heart?
dsp73

Answer:

A frogs heart has 3 chambers. Two atria and a single ventricle. 

7 0
3 years ago
would sound travel faster in a thick piece of metal (high density) or a large hallow piece of metal ( low density ) ? explain wh
katen-ka-za [31]

Sound would travel faster in a thick piece of metal since the molecules are closer together. However, since there are more molecules, it would be quieter on the other side than the hollow metal.

6 0
3 years ago
Read 2 more answers
Uhmmmmmm i need help asap!!! plss and thanks lol
n200080 [17]

Answer:

C

The while reason we wash fruits and vegetables before consumption is because we need to wash off the pesticides

7 0
3 years ago
Read 2 more answers
The nurse is caring for an older adult with mild dementia admitted with heart failure. what nursing care will be helpful for thi
jarptica [38.1K]
<span>1. Reorient frequently to time, place, and situation. 2. Put the client in a quiet room furthest from the nursing station. 3.perform necessary producers quickly 4.Arrange for familiar pictures or special items at bedside. 5.Limit the client visitor's. 6.spend time with clients ,establishing a trusting.</span>
3 0
3 years ago
Other questions:
  • What will be the percentage of potassium-40 remaining after 3.9 billion years?
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How is this person able to stay on the skateboard
    5·2 answers
  • An oil well is usually drilled into
    11·2 answers
  • G Which of the following statements is false?
    15·1 answer
  • The geyser Old Faithful in Yellowstone National Park is powered by what kind of energy?
    15·1 answer
  • What is a neap tide? What causes a neap tide?
    6·1 answer
  • Can someone please help me answer this please?
    14·1 answer
  • Proteins are made up of one or more unbranched chains of
    13·1 answer
  • 6. What feature of a DNA fragment causes it to move through a gel during electrophoresis
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!