1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
4vir4ik [10]
2 years ago
9

Cutting down forests changes the populations of more than trees. Imagine the organisms that lived in this forest. After the tree

s have been cut, fewer animals can survive here. What are MOST LIKELY the limiting factors in this case?
Biology
1 answer:
Alex_Xolod [135]2 years ago
6 0

Answer:

<em>Food and shelter are the most likely limiting factors in this case.</em>

Explanation:

In a forest, the huge trees act as a source of shelter for the animals that live in that habitat. It protects the animals from the heat of the Sun and extreme cold conditions.

The tress in the forest are the primary source of food for almost all the organisms that live in the forest. Cutting down trees will lead to food scarcity for the animals which inhabit that forest. As a result, the animals will either have to migrate or they will become die due to lack of food.

Hence, food and shelter are the limiting factors in this case.

You might be interested in
Describe the functions of organelles inside of an animal cell.
levacccp [35]

Answer:

Do u mean in A level or GCSE'S?

3 0
3 years ago
This graph shows the effects of an enzyme on a particular reaction. The red line on the graph shows the reaction without the enz
olya-2409 [2.1K]

Answer: The first blank is “does not”

The second blank is “reduces”

The third blank is “stays the same”

4 0
3 years ago
If a cell has the ability to take in water, food molecules, and other necessary materials this indicates it is capable of
Ilia_Sergeevich [38]

The correct answer is D. Digestion.

Digestion is termed as the breakdown of food which has large insoluble molecules to small soluble molecules which makes them to be absorbed in the blood plasma.

Based on the way which food is being broken, it will depend on the form of catabolism which is used in the digestion. For example, catabolism is divided into chemical and mechanical digestion where mechanical digestion breaks down large to small pieces of food.

Those pieces of food are accessed by digestive system. In chemical digestion it is the enzymes which broke down molecules of food.

7 0
3 years ago
Identical twins who have separate placentas are somewhat less similar than identical twins who share a placenta. This best illus
Jobisdone [24]

Answer:

prenatal environments

Explanation:

Depending on the number of fertilized eggs and when the zygote division occurs, there are different types of twins. For example, If the zygote is formed by the union of an ovule and a sperm that after fertilization is divided to create two embryos, they are born identical twins, these babies carry the same genetic information.

4 0
2 years ago
Where in water is being converted into a gaseous form?
DiKsa [7]

Answer:

evaporation

Explanation:

all the others have a completely different meaning

hope it helps, pls mark me as brainliest

7 0
3 years ago
Other questions:
  • Why is the cycling of elements essencial to life
    9·1 answer
  • Why does water roll off a person's skin when the person gets out of a
    13·2 answers
  • What is the major role of NAD+?
    8·2 answers
  • Uncle Smiley is heterozygus for a yellow face, married a woman with a green face.Both of them always wanted a large family! If t
    9·1 answer
  • What is a environmental variable that effect wing color
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Where should Jack place an X for the investigations in the table? in Box 1 in Box 2 in Box 3 in Box 4
    10·2 answers
  • What are some closely related animals to the Marine Iguana?
    14·1 answer
  • HELPP I NEED SOME ANSWERS PLEASE ILL GIVE BRAINLIEST!
    11·1 answer
  • Glycolysis that starts with glycogen instead of glucose can be considered to have a higher energy yield because?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!