1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mice21 [21]
3 years ago
14

Which is the only plate boundary that doesn't involve magma is kowhn as?

Biology
2 answers:
alisha [4.7K]3 years ago
6 0

Answer:

The plate boundary that doesn't involve magma is the transform plate boundary. However, there's another boundary plate where magma is not involved, it's an specific type of convergent plate boundaries and its the collision between two continental plates.

Explanation:

In the case of transform plate boundaries, the movement between the plates is just horizontal and there is not a possibility to magma to ascend because they are not creating a space to allow the rise of magma and there is not a plate subductng and melting as in the case of divergent and convergent boundaries respectively.

For the case of the convergent boundary where the collision is between two continental plates, theres is not magma involved because none of the plates goes down under the other, there is not subduction and there is not melting to generate magma ascent. In this cases there is a big crust strain that forms very high mountains as in the case of the Himalayan mountains.

VladimirAG [237]3 years ago
5 0

The answer is the Transform Boundary. There are three kinds of main types of tectonic plate boundaries and aside from Convergent, Divergent there is also transform boundary. Some called it the sliding because the two plates slide past each other that why earthquakes occur mostly in transform boundary.  The divergent is describe as dividing and other convergent called colliding.

You might be interested in
What does each brick in this model represent?
Naily [24]
The answer should be A plant cell
6 0
3 years ago
Read 2 more answers
What are the main constituents of the jovian planets?.
alexira [117]

Answer:

Unlike the terrestrial planets that make up our inner solar system — Mercury, Venus, Earth, and Mars — the Jovian planets do not have solid surfaces. Instead, they are composed primarily of hydrogen and helium, with traces of methane, ammonia, water, and other gases in their atmospheres.

I think it will help you.

8 0
2 years ago
Jane just ate kale, a high-calcium food. This would likely cause
Arte-miy333 [17]
I think it's D ^-^
If it's not then it is B
3 0
3 years ago
Read 2 more answers
How do i describe the ATP molecule and its functions within the cell
Darina [25.2K]
<em>ATP stands for denosine tri phosphate ..
<u>formation:
</u>it is formed in the respiration ..also 36 molecules of ATP are formed during break down of 1 glucose molecule ..
<u>function:
</u>its function is to provide energy  ,, 
<u>how it provides energy:
</u>when one phosphate molecule separate ATP is converted into ADP and energy is released..
and when one phosphate is separated from ADP AMP is formed and energy is released ..
</em>
7 0
3 years ago
Could a cell grow large enough to engulf your school
Sergio039 [100]
No not a singular cell but many could join up together..
4 0
3 years ago
Read 2 more answers
Other questions:
  • What drugs are examples of second-line opioid agonists/antagonists prescribed for the treatment of moderate-to-severe pain? sele
    10·1 answer
  • Describe 3 observation an astronaut might make while viewing russia at night?
    10·1 answer
  • Over time, a river gradually shifts its position back and forth across a valley bottom. As it shifts, it drops sediment to gradu
    10·2 answers
  • Nucleus acids offer variability because they contain alternate forms of genes called
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • the speed of light is 3.0 x 108 m/s how far does light travel in one day? remember that you should first convert the day into se
    8·1 answer
  • Which hormone signals body cells to take in glucose
    11·2 answers
  • Which is an example of a mineral being used in everyday life?
    8·1 answer
  • If a gene has a proportion of 25% adenine, what is the proportion of thymine in that gene
    9·1 answer
  • What are the importance of human and social biology​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!