1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alona [7]
3 years ago
8

Cellular respiration is the process that converts nutrients into ATP (adenosine triphosphate), a storage molecule that

Biology
2 answers:
Aloiza [94]3 years ago
4 0

Answer:

The answer is B.

Explanation:

A is incorrect because B is correct (plants are autotrophs).

C is incorrect because the first stage of cellular respiration is glycolysis, and the second is the Krebs cycle, neither of which require oxygen.

D is incorrect because cells take in oxygen to perform cellular respiration. Carbon dioxide is the product.

jeka57 [31]3 years ago
4 0

Answer:

B. Plants perform photosynthesis and cellular respiration.

Explanation:

Cellular respiration is used by most living beings to obtain vital energy for their survival.

It can take place through the aerobic process, which uses the oxygen present in the environment. But it can also occur anaerobically, when oxygen does not participate.

Also in anaerobic respiration, fermentation can occur, which gives rise to yogurt and alcoholic beverages.

Although it is performed by all living beings, only plants perform photosynthesis and cellular respiration.

Although it is a very complex process, cellular respiration is done through various chemical reactions, we can simplify it. A summary can be made in the following equation: C6H12O6 + 6 O2 ⇒ 6 CO2 + 6 H2O + Energy

You might be interested in
Lateral gene transfer between individuals of a species is called
adelina 88 [10]

Answer:

Horizontal gene transfer.

Explanation:

Horizontal gene transfer happens when an organism acquires a gene that benefits its development. This individual then can transfer this information to another cell without it being its breed or duplicate. Normal gene transfer happens "vertically" from a parent to a daughter cell, but in this case, duplication is not needed for another organism to acquire the gene.

6 0
3 years ago
An increase in the biodiversity of an ecosystem leads to an increase in its productivity.
Liono4ka [1.6K]

Answer: Your answer is True.

Explanation:

8 0
3 years ago
Which statements accurately describe the roles of decomposers in the carbon cycle?
ollegr [7]

Answer:

The question is incomplete, here's the complete question;

Which statements accurately describe the roles of decomposers in the carbon cycle? Check all that apply.

-Decomposers release carbon dioxide into the air as waste.

-Decomposers remove carbon dioxide from the air during photosynthesis.

-Decomposers break down the remains of dead plants and animals.

-Decomposers return carbon compounds to the soil.

-Decomposers use carbon to make food molecules.

The correct answer is;

Decomposers release carbon dioxide into the air as waste.

Decomposers break down the remains of dead plants and animals.

Decomposers return carbon compounds to the soil.

Explanation:

In the earth, all living things are made up of carbon. Carbon cycle is the process in which carbon travels from the atmosphere into living things in the earth and then returned into the atmosphere.  Carbon is released into the atmosphere through processes like respiration, decomposition, combustion etc. The carbon cycle explains how carbon is stored, made available to living things and replaced on earth. Plants absorb carbon in the form of carbon dioxide from the atmosphere and use it to produce food (glucose) and release oxygen in a process called photosynthesis. When animals feed on these plants , the carbon is transferred to them and thus passes it along the food chain. During respiration, animals release carbon dioxide back into the atmosphere. When the organisms eventually die, the carbon from them is put back into the atmosphere by decomposers so that other living organisms can use it. Decomposers break down dead organisms , releases carbon dioxide through cellular respiration and enriches the soil with nutrients.  The examples of decomposers are bacteria, fungi and worms. Bacteria decomposes most types of organic matter. Fungi are the main decomposers in the forest as they break down wood and the cellulose in plant cell walls. Decomposers are very important because they release carbon locked up in the dead organisms back into the atmosphere and without carbon dioxide in the atmosphere plants can not produce glucose and oxygen.

8 0
3 years ago
Which type of ovarian follicle contains a secondary oocyte?
Illusion [34]
I think it is the secondary ovarian follicle that contains the secondary oocyte.The stages of the ovarian cycle that the follicle will go through includes; a primary follicle contains an oocyte and begins producing estrogen. Then the secondary oocyte contains a secondary oocyte and produces estrogen and some progesterone, then the graafian follicle develops and the secondary oocyte is released a process we call ovulation. the corpus luteum produces progesterone and some estrogen and lastly the corpus luteum degenerates.
3 0
3 years ago
How does natural selection lead to the development of antibiotic-resistant bacteria? ​
sladkih [1.3K]

Answer:

antibiotic resistant is a consequence of evolution via natural selection. the antibiotic action is an environmental pressure;those bacteria which have a mutation allowing them to survive will live on to reproduce

please mark me as brainlist please

6 0
3 years ago
Other questions:
  • Which best describes tbe reactants and products of photosynthesis?​
    8·2 answers
  • Mass of an orange<br><br> A.Meter<br> B.Liter <br> C.Kelvin<br> D.Kilograms
    5·2 answers
  • if there is a toxin present in the primary producer population, how might this affect organisms at higher topic levels?
    7·1 answer
  • What are the overriding problem with both theories of muscle growth
    8·1 answer
  • What is the gastrointestinal system? What does it do?
    9·1 answer
  • When Alfred Wegener first noticed that the continents fit together like puzzle pieces, this was
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • When a school of fish spawns, the males and females release sperm and eggs into the water. A sperm and egg cell unite to form th
    5·1 answer
  • How do fronts affect the formation of tornadoes?
    10·1 answer
  • Which of the following substances is the strongest acid in the simulation?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!