1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anni [7]
3 years ago
7

Cell walls are made out of cellulose. What type of organic compound is this?

Biology
2 answers:
Paladinen [302]3 years ago
5 0
Cellulose is composed of glucose molecules linked by beta glycosidic bonds
AleksandrR [38]3 years ago
4 0
Organic compound is generally any chemical compound that contains carbon. Due to carbon's ability to catenate (form chains with other carbon atoms), millions of organic compounds are known. Study of the properties and synthesis of organic compounds is the discipline known as organic chemistry. For historical reasons, a few classes of carbon-containing compounds (e.g., carbonates and cyanides), along with a handful of other exceptions (e.g., carbon dioxide), are not classified as organic compounds and are considered inorganic. No consensus exists among chemists on precisely which carbon-containing compounds are excluded, making the definition of an organic compound elusive.[1]Although organic compounds only make up a small percentage of the Earth's crust, they are of central importance because all known life is based on organic compounds. Most synthetically produced organic compounds are ultimately derived from petrochemicalsconsisting mainly of hydrocarbons.
You might be interested in
How are algae cells different from other cells
Arte-miy333 [17]

Answer:

In the case of the algae, each individual cell is responsible for absorbing its own water. This makes the algae nonvascular compared to the highly vascular plant species. In this connection, algae also lack several key structures that are normally present in ordinary plants like the leaves, roots and stem.

6 0
2 years ago
Read 2 more answers
What would your body be like if you did not have any bones
klasskru [66]
It would be a blob of muscle and veins
8 0
3 years ago
Read 2 more answers
What is the mRNA copy of the DNA strand: TAC AAA GTT AGA GAG TAG ATC
Nitella [24]

Answer:

AUG UUU CAA UCU CUC AUC UAG

Explanation:

4 0
2 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Are human animals please hurry
gavmur [86]

Answer:

All mammals (including humans) have the same distinctive features. These include: fur or hair growing from the skin. mammary glands that, in females, produce milk for feeding the young.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • He lifespan of an unfertilized egg is about _____ hours
    14·2 answers
  • What energy storing molecule(s) are produced by the Krebs Cycle that go to the Electron Transport Chain?
    8·2 answers
  • Which organelle do you think is involved in autolysis? Explain
    12·1 answer
  • If fission takes place every 20 minuets in some bacteria, then starting with one bacterial cell, how many cells would be produce
    10·1 answer
  • Hair pigmentation in mammals follows the generic enzymatic pathway depicted below. Enzyme A synthesizes a black pigment from a p
    13·1 answer
  • John is blind and is therefore unable to detect the light that normally sets the suprachiasmatic nucleus (SCN). If he is like mo
    5·1 answer
  • Is it important to have a family
    9·1 answer
  • Why do flowers have pigment, not how but the reason they have pigment
    12·1 answer
  • Someone help me please ​
    13·1 answer
  • Part C
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!