1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
5

3 questions, I really need help.

Biology
1 answer:
Lesechka [4]3 years ago
5 0

Answer:

I can help with 3- being made of small cells can help animals and beings maintain homeostasis by being able to get more out of a small space quicker.  With small cells, they have less area to cover and worry about keeping at the perfect temperature.  With less work, this makes it easier to keep at the perfect state for life.  When the cell is large, the opposite is true.  The large cell has more space to look over and keep at a perfect state for living.  This will make larger cells die easier than small cells.

blackpink is the revolution

You might be interested in
Only 3% of the water on earth is fresh water, the kind we need for drinking and growing food. Of that 3% , how much is locked in
spin [16.1K]

about...69%

or more than two-thirds

4 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which of the following is a type of tissue in plants that is dead at maturity?
victus00 [196]

Answer:

The correct answer will be option-B.

Explanation:

The plant tissues are composed of three types of cells: parenchyma, collenchyma and sclerenchyma.

The parenchyma and collenchyma remain alive at their maturity but sclerenchyma loses their protoplasm and become dead. These cells deposit lignin in their secondary walls and form hard tissues of the plant-like hard shell of a coconut. Sclerenchyma provides mechanical strength to the plant.

Thus, Option-B is the correct answer.

3 0
3 years ago
How will the enzymes in these bacteria most likely change if the temperature is lowered to 45
larisa [96]
The enzyme will likely be less affective or more affective, however, it depends on what the perfect temps tire is. since this sounds like it is lowering its temp from the “ideal range”, the enzyme will be less effective!
8 0
4 years ago
An hypothesis does not have to be correct when first stated. An hypothesis is often a guess about what is observed
Svetlanka [38]
The answer is true. A.
4 0
4 years ago
Other questions:
  • Which statement best describes a climax community? Hurry PLZ ITs A TEST!!!
    5·2 answers
  • The most primitive vertebrates whose reproductive pattern includes the amniotic eggs are the _____. the most primitive vertebrat
    8·1 answer
  • Buatlah kunci determinasi dari tumbuhan manga, jati,cemara,pepaya,padi dan pinang!
    14·1 answer
  • Your lab group is presented with an unknown mollusk. Your task is to assign it to one of the major taxonomic classes. Which char
    12·1 answer
  • At what stage of development is the embryo a hollow ball of identical cells?
    8·1 answer
  • The PCR technique requires a DNA polymerase from an organism that can endure high heat, such as Thermus aquaticus. What step of
    7·1 answer
  • Tectonic plates are the moving pieces of the lithosphere. What force
    10·1 answer
  • Which of the following best describes how plants obtain the materials necessary to perform photosynthesis?
    9·2 answers
  • Which of the following statements best describes the process of photosynthesis?
    9·1 answer
  • Cuando una persona introduce su mano en agua caliente, la retira rápidamente como acción defensiva, En este caso el estímulo es:
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!