1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mestny [16]
3 years ago
8

Which of the following describes aggregations

Biology
1 answer:
Anarel [89]3 years ago
4 0

the following what anyways it means the formation of a number of things into a cluster. i hope it helped

You might be interested in
What is the fitness of an organism?
dlinn [17]

Answer:

Answer B.

Explanation:

Biological Fitness, also called darwinian fitness, means the ability to survive to reproductive age, find a mate, and produce offspring. basically, the more offspring an organism produces during its lifetime, the greater its biological fitness.

3 0
3 years ago
Bird guides once listed the myrtle warbler and Audubon's warbler as distinct species. Recently, these birds have been classified
taurus [48]

Answer:

The correct answer is A). The two forms are observed to interbreed successfully where their habitats overlap.

Explanation:

According to the biological species concept, the members in a population which interbreed with each other and produce viable offsprings comes under the same species. This classification does not involve morphology because even organisms having the same morphology can be of different species because they do not interbreed with each other in nature.

So here myrtle warbler and Audubon's warbler must be found interbreeding with each other and producing offsprings which have good survival rate and reproductive capability so this information might allowed scientists to reclassify these bird in the same species because only members of same species interbreed with each other. So the correct answer is A.

5 0
3 years ago
Drag the words to complete the sentences.
lina2011 [118]

The Replication process in eukaryotic and prokaryotic cells is quite similar. Almost the same enzymes are involved. 1)eukaryotic, 2)multiple, 3)circular.

<h3>What is the prokaryotic DNA replication process?</h3>

In prokaryotic cells,  DNA Replication consists of the unwinding and opening of the double-stranded DNA molecule, a process that starts at the replication origin.

The process is completed in three stages,

⇒ Initiation, in which helicase and topoisomerase are the first enzymes involved.

Helicase works in the replication origin.

  • It separates the DNA into two strands allowing the replication fork to advance by unwinding the DNA.
  • It breaks hydrogen bonds between nitrogenated bases pairs.

Topoisomerase impedes the DNA double helix near the replication forks to get too coiled when the DNA is opening.

⇒ Elongation, in which DNA polymerase I and III, primase, and ligase act,

Polymerase I and III are responsible for DNA elongation.

  • They are in charge of adding nucleotides to the growing chain, from 3' to 5' extremes.
  • It includes only nucleotides that complement the original strand.
  • They need to recognize a primer to begin.
  • The new chain grows in 5’-3’ direction

Primase is in charge of synthesizing primers.

DNA polymerase I eliminate ARN primers and substitute them with DNA.

DNA ligase seals the gaps that remain after replacing the primers.

⇒ Mistakes correction

Endonuclease cuts the wrong segment

Polymerase I and III are in charge of correcting errors and filling empty spaces.

Ligase seals the corrected extremes.

The prokaryotic replication result is two DNA molecules, each of them carrying an old strand and a new strand.

<h3>What is the eukaryotic DNA replication process?</h3>

Eukaryotic DNA replication is the process through which DNI molecule duplicates. This event takes place during the S stage of the interphase. So when the cell divides during mitosis or meiosis, each cell will get a complete set of chromosomes.

DNI replication is semi-conservative because each new molecule carries an original DNI strand and a new one. The fact that the new molecule is composed of an original strand makes it semi-conservative. The old existing strands are used to synthesize the new complementary strand.

The main difference concerning the prokaryotic replication process is that in eukaryotic cells there are

  • 5 different polymerase enzymes
  • several replication origins per chromosome
  • involves histones

The origin of the replication requires

  • The helicase enzyme breaks hydrogen bonds and separates the two original strands.
  • The topoisomerase enzyme is necessary to release tension.
  • Other proteins are also needed to join the strains and keep them separated.

Once the molecule is opened, there is a region named replication forks.

  • DNA polymerase makes the new nucleotides enter the fork and pairs them with the corresponding nucleotide of the original strand. Adenine pairs thymine, and cytosine pairs guanine.

DNA strands are antiparallel, and replication occurs only in 5'-3'direction. So one of the strands will replicate continuously, while the other strain will be formed by short fragments known as Okazaki fragments.

Primers are needed to make the DNA polymerase work. Primers are small units of RNA and are placed at the beginning of each new fragment. These are later eliminated by Polymerase.

Ligase seals the gaps.

<u>Complete sentenses</u>

Before a cell divides, its DNA must be replicated without errors so that the genetic codes for proteins are expressed properly. In<u> </u><u>eukaryotic</u><u> </u>cells, which have linear chromosomes, replication occurs in<u> </u><u> multiple  </u>locations and ends when all the chromosomes are copied. In prokaryotic cells, which have<u>  </u><u>circular  </u>DNA, replication starts in only a single location and proceeds until the entire chromosome is copied.

You can learn more about replication process in prokaryotic and eukaryotic cells at

brainly.com/question/21675925

brainly.com/question/12250616

brainly.com/question/13762319

brainly.com/question/13064177

4 0
2 years ago
Read 2 more answers
“What is the effect of the type of food available on the frequency of different types of bird beaks?” The the lab procedure you
Pie
If the food type changes in a given environment, then the amount of each type of bird beak will change as birds with beaks more suited to the available food will consume more successfully over time. <span>The independent variable of the lab is the type of food that is available to the birds. The dependent variable of the lab is the frequency of each type-size and shape-of beaks. The conclusion will state that favourable traits place one species in a more optimal position to survive in a given envronment.</span>
4 0
3 years ago
Read 2 more answers
Explain how the structure of red blood cells white blood cells and platelets relates to the function of these cells
Monica [59]
Rbc dont have a nucleus to pack more haemoglobin. it also has a biconcave shape to increase surface area.... idk about the other two. sorry
8 0
3 years ago
Other questions:
  • Which of the following are individual components of a cell that operate like microscopic organs to keep a cell healthy.
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How much of the sun's energy is reflected back into space?
    8·2 answers
  • Two humans can have different traits because they
    8·2 answers
  • Are Flakes of brick Mechanical or Chemical Weathering
    9·2 answers
  • Three types of cartilage are
    14·2 answers
  • Plz help!
    12·1 answer
  • What is matter?
    14·2 answers
  • A scientist viewing a cell under a microscope sees that it has a cell wall and a large number of ribosomes. Based on these obser
    7·2 answers
  • Half of the moon is always lit except during an eclipse.<br><br> True or false?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!