Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
A nuclear power plant will use nuclear energy to power the town. While nuclear energy is perhaps one of the most effective ways to provide power, a nuclear accident is very dangerous, and could destroy an environment and its organisms. There was a nuclear accident in Chernobyl, Ukraine, in the 1900s. people had to evacuate because of it.
The external covering of diatoms are made up of, while slime molds have cell walls containing. diatoms are because they make food through photosynthesis, while slime molds are because they eat decaying plant matter
I believe it would be the bronchiole
