1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OleMash [197]
3 years ago
11

1) Why do the different rocks exposed in the Grand Canyon appear in layers for the most part?

Biology
1 answer:
soldi70 [24.7K]3 years ago
5 0
Hey do you still need the answer i have the first one but im still working on the rest im in k12 to xD

1)    *The oldest rock layers of rocks are found on the bottom, well the youngest rocks are found on top. The different colors of these layers are caused by many different minerals and materials and a main two of the main rolls are iron and climate

that is what i have for the first one

You might be interested in
Is throwing a paper bag out of the window of a car by saying it is biodegradable? why
malfutka [58]

Answer:

Is throwing a paper bag out of the window of a car by saying it is biodegradable.

Explanation: I feel like your missing something this question doesnt make sense

7 0
3 years ago
Read 2 more answers
In what part of the mrna does degradation generally begin?
noname [10]
When the mrna has done it's job for the celll and is no longer of any use, it starts to degeneate
3 0
3 years ago
Do pregnant women eat the same food as builders. backup ur answer/reason​
8_murik_8 [283]

Answer:

no they don"t they eat different food

Explanation:

they eat different food that they are craving

3 0
2 years ago
Read 2 more answers
The major source of sediments found on the deep ocean bottom is
Harman [31]
There are two main sources of ocean sediment:

<span>1.External (terrigenous) formed from the deposit of insoluble materials, like <span>rock and soil particles. It is transported from land areas to the </span>ocean by wind, ice, and rivers. It also includes products of submarine volcanism.</span>
<span>
2. Internal (biogenic and authigenic) formed from the remains of marine organisms or their shells and from chemical precipitates from the seawater.</span>
4 0
3 years ago
If soil is found on the bottom of a shoe, the soil is left on the shoe and the entire shoe is taken to the crime lab.
Tcecarenko [31]
The answer should be True
4 0
3 years ago
Read 2 more answers
Other questions:
  • What does crop rotation do?
    10·2 answers
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Rna differs from dna in all except which of the following ways?
    8·1 answer
  • PLZ HELP ME
    15·1 answer
  • Two new species of plants were introduced into an area that was low in available nitrogen compounds in the soil. One formed nodu
    12·1 answer
  • A pond containing fish, frog, ducks, and lily pads is affected by pollution. What statement describes the animals that are most
    15·2 answers
  • One of the major differences between weather and climate is that weather changes more quickly than climate.
    7·2 answers
  • Help please!!!! Which table below matches the graph above
    11·2 answers
  • If a scientific journal article is difficult to understand in its entirety, what is the best resource for comprehending the over
    8·2 answers
  • All the following are ways by which animals help to sustain the carbon cycle except
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!