1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldi70 [24.7K]
3 years ago
9

What functions do capillaries perform in the body?

Biology
1 answer:
DerKrebs [107]3 years ago
5 0
Blood Capillaries are the smallest of the body's blood vessels they help carry nutrients and oxygen in to the blood stream
hope this helps
You might be interested in
the organelle is found in cells of _________ and is theorized to have once been an independent organism.
lyudmila [28]
The mitochondria and cholorplasts are the 2 organelles found in eukaryotic cells that are supposed to have been independent long ago :)
8 0
4 years ago
Read 2 more answers
HELP I NEED THIS NOWW!!!
BARSIC [14]

Answer:

fool

Explanation:

go to chrome and search

8 0
3 years ago
Peacocks (the males) have very long feather trains, while peahens (the females) do not. Why don’t the feather trains just get lo
attashe74 [19]
<span>The male's feathers do not get longer and longer each generation because they would reach a point in which the feathers would hinder their survival. If the females preferred feather trains that would help males fly, then males would likely have much shorter feather trains.</span>
3 0
3 years ago
I need help, please ASAP!!!!
Margarita [4]

Answer:

Oxygen Ion: -1 charge

Sulfur Ion: Neutral charge

Explanation:

Protons always have a + charge.

Electrons always have a - charge.

Oxygen:

If we have 8 protons and 9 electrons, we can see that we would only have +8 charge vs a -9 charge. Therefore:

8 - 9 = -1 charge overall

Sulfur:

If we have 16 protons and 17 electrons, we can see that we would have an overall charge of -1:

16 - 17 = -1 charge overall

However, since we lost an electron, we now only have 16 electrons:

16 - 16 = 0 charge, or neutral overall

8 0
3 years ago
A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
padilas [110]

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

4 0
3 years ago
Other questions:
  • _____ carry information to the brain, and _____ relay information from the brain to the muscles.
    8·1 answer
  • When a cell is infected by a virus, synthesis of ______ begins and this protein diffuses away from the infected cell to protect
    13·1 answer
  • Milk production during breastfeeding is increased by the suckling of a newborn from his mother's nipple. this type of feedback m
    12·2 answers
  • What does a ripened ovary develop into in a flowering plant?
    5·1 answer
  • A man whose father, sister, maternal grandmother and both grandfathers developed diabetes is concerned that he might also develo
    13·2 answers
  • Which properties of grains determine the texture of rocks? Check all that apply. -feel
    10·2 answers
  • Another name for potential energy is stored energy.
    12·1 answer
  • Two brown eyed parents (Bb) have a baby, What are the genotypes of<br> the offspring?
    6·1 answer
  • What is community pls tekk​
    8·2 answers
  • in its second messenger role, cAMP activates enzymes called ____________, whose jobs is to regulate other enzymes by adding phos
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!