<span>My pea plant has an unknown genotype for flowers, whether it has two dominant traits for white flowers (WW) or one dominant and one recessive (Ww) leading to white flowers; therefore I am doing a testcross in order to determine the genotype of my pea plant. The best plant to do this with is one that has a phenotype of purple flowers (ww) - that is, it is homozygous for the recessive trait.
If I use a homozygous recessive plant, I know exactly what its genotype is. I don't have to worry about whether it's got one or two dominant alleles; I know that at least half of my alleles are going to be the recessive w.
This makes identifying the offspring's genotype very simple. If I find that the offspring have at least some purple flowers among them, I know that my original plant had to be Ww; that is it had to have one dominant and one recessive allele for the flower color gene. If, however, all of the offspring are white flowers, I know that my original pea plant had both dominant alleles (WW).</span>
Ezywhen salinity in soil increases the soil becomes hypertonic when compared to cell sap.the movement of particles from a lower concentrated solution to a higher concentrated solution is callede osmosis. in general conditions cell sap is at higher conc. than surrounding media. this allows water and minerals to enter the plant. but when soil is at higher conc. i.e., when its salinity increases the process becomes reversed can you imagine its consequenses?
Answer:
Soil erosion affects soil health and productivity by removing the highly fertile topsoil and exposing the remaining soil. It decreases agricultural productivity, degrades ecosystem functions and amplifies hydrogeological risk, such as landslides or floods
Explanation:
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer: Option D
Explanation:
Once the pathogen enters the body, it starts dividing and after a certain period of time the patients experience some sign and symptoms of illness.
The prodromal period occurs just after the incubation period. In this phase the pathogen keeps on dividing and the host begins to experience general symptoms and signs of illness.
This is a result of the activation of immune system of the body which results in the swelling, pain, soreness.
