1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
steposvetlana [31]
3 years ago
13

Un hombre de grupo sanguíneo A y una mujer de grupo AB pueden tener descendientes de grupo sanguíneo

Biology
1 answer:
Lynna [10]3 years ago
7 0

Explanation:

AB or A or B are the possibilities

You might be interested in
I have a question about this video my teacher sent me, how do I find the variable in this?
Masja [62]

answer:you got rick rolled

8 0
3 years ago
Maggots feed on dead and decaying organisms for energy. What are maggots?
Vikentia [17]
Maggots consume dead or decaying organisms so they are classified as a decomposer.

Decomposition is a process by which organic substances, like leaves or dead animals, are broken down into simpler matter.
A lot of different types of organisms, called the decomposers, will consume the organic substances and continue an essential part of the nutrient cycle. These organisms can be both bacteria, fungi but can also be insects.

This is important for recycling the organic matter that occupies space in the biosphere and that way, continues the movement of energy and matter in ecosystems.
4 0
3 years ago
Read 2 more answers
A mutation within a gene that will insert a premature stop codon in mrna would _______
AveGali [126]

A mutation within a gene that will insert a untimely cease codon in mRNA would result in a shortened polypeptide chain.

<h3>What occurs if there is a untimely end codon?</h3>

Thus, nonsense mutations occur when a premature nonsense or end codon is added in the DNA sequence. When the mutated sequence is translated into a protein, the resulting protein is incomplete and shorter than normal. Consequently, most nonsense mutations result in nonfunctional proteins

<h3>What mutation motives untimely cease codon?</h3>

In genetics, a nonsense mutation is a factor mutation in a sequence of DNA that effects in a premature stop codon, or a nonsense codon in the transcribed mRNA, and in a truncated, incomplete, and normally nonfunctional protein product.

Learn more about mutation here:

<h3>brainly.com/question/17031191</h3><h3 /><h3>#SPJ4</h3>

6 0
1 year ago
First dropdown options:
TEA [102]
I believe the first answer is C) evaporation. second answer B) transpiration, and the last answer is A) raindrops.
8 0
3 years ago
When looking at your pictures in order, describe the changes to the area. What changes happened first? Why do you think that is?
Veronika [31]

Answer:

5. no i think that its the same as number 2 because based on number 2, at first there is climate change but then, flowers began to grow which is similar to the pictures protrayed in the website where at first forest trees are burned and then colonizing trees helped to change the landscape

hope this helps! :)

7 0
3 years ago
Read 2 more answers
Other questions:
  • What is primary succession?
    8·2 answers
  • Mitosis is done to produce _____ calls.​
    9·1 answer
  • .
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What is the general relationship between global earthquake activity and plate boundaries?
    13·1 answer
  • Which first-line defense system uses acids to kill pathogens?
    14·2 answers
  • 10 points plus brainliest! please help!!
    9·2 answers
  • What is kinetic energy
    9·2 answers
  • In what order do these three organ systems of the human body operate during a reflex arc in response to a stimulus of sharp pain
    5·1 answer
  • PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!