1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fiasKO [112]
2 years ago
9

An older adult client who has type 1 diabetes and chronic bronchitis is prescribed atenolol for the management of angina pectori

s. which clinical manifestation should alert the nurse to the fact that the client may be developing a life-threatening response to the drug?
Biology
2 answers:
Goryan [66]2 years ago
8 0
The nurse should look out for symptoms such as extreme tiredness /severe dizziness, very low heart rate, trouble breathing, and swollen toes and finger (could turn blue also). This should show that the patient is developing a severe allergic reaction to the drug that could lead to heart failure.
Leno4ka [110]2 years ago
6 0

Answer: difficulty breathing

Explanation:

You might be interested in
Help!!!!!!!! Pls help!!!!!!!!!
nignag [31]
Genotype of the Q gene is homozygous dominant
3 0
2 years ago
Read 2 more answers
Coat color in cats is a codominant trait and is also located on the X chromosome. Cats can be black, orange or calico. A calico
adell [148]

Answer:

The males can only either be black or orange

Explanation:

There can be no male calico because for an offspring to be a calico the two codominant alleles must each be carried on the two X chromosomes and in the males, there is the presence of just one X chromosomes, thus they can either be black or be orange. For the females, the can only be black if they carry the black allele on both X chromosomes, the same goes for the orange.

Parents                          XB            Y

    XB                          XBXB        <u>XBY</u>

    XC                          XCXB       <u> XCY </u>      

XBY- black male

XCY- orange male          

7 0
3 years ago
pinworms have smooth bodies bilateral symmetry and complete digestive tracts. what type of animal are they
Dvinal [7]

Pinworms are also known as threadworm or seat worm in some countries. Its Scientific Classification:
Kingdom: Animalia
Phylum: Nematoda
Class: Secernentea
Subclass:  
There are different types of pinworms in humans and animals. They spread by touching contaminated object they are also parasitic worms. 
7 0
3 years ago
The hormone that is primarily involved in the control of bone remodeling is calcitonin.
Ainat [17]

Answer:

The correct answer will be-False

Explanation:

Calcitonin is a hormone produced by the parafollicular cells present in the thyroid gland. The Calcitonin plays an important role in the human body as they reduce the level of phosphate and calcium in the blood.

The calcitonin is produced by the C-cells in response to the amount of the calcium levels in the blood as a high concentration of calcium cause release of calcitonin.

Since the calcitonin is involved in the regulation of calcium of blood and not bones therefore, false is the correct answer.

3 0
3 years ago
Read 2 more answers
Which is the best hypothesis for the extinction of the dinosaurs at the end of the Cretaceous period?
Setler79 [48]
I think the answer will be A.
3 0
2 years ago
Other questions:
  • Match the following terms and definitions. 1.breeding of individuals that have genes for two different characteristics codominan
    7·2 answers
  • Paving a large parking lot could interrupt or hurt which of the following?
    13·1 answer
  • Paralysis is a term used to describe the loss of muscle function. if tetrodotoxin's effect is on neurons, why did dr. westwood e
    15·1 answer
  • Why is sodium potassium pump important
    14·2 answers
  • 1. Ash from a volcanic eruption decreases the amount of available solar energy for a region. How will a decrease in available su
    9·1 answer
  • For a couple of decades, biologists knew the nucleus contained DNA and proteins. The prevailing opinion was that the genetic mat
    7·1 answer
  • The membranes of the mitochondria provide a place for enzymes needed for ________to anchor and function.
    7·2 answers
  • Using depressants can cause loss of coordination, slurred speech, confusion, and a slowed heart rate. These symptoms can lead to
    15·1 answer
  • Chitin is a long-chain polymer derived from glucose. It strengthens cell walls of fungi and the outer covering (exoskeleton) of
    14·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!