1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ainat [17]
3 years ago
5

The study of the ways living things function.

Biology
2 answers:
Sedaia [141]3 years ago
5 0
D physiology is the study of the ways living things function
Doss [256]3 years ago
3 0

Answer:

The study of the ways living things function is called physiology

Explanation:

You might be interested in
Instead of using a family tree, scientists use a(n) _____ tree to track the evolutionary history of a species. inheritance evolu
VashaNatasha [74]
Phylogenetic

Scientist use a phylogenetic tree to track the evolutionary history of a species.
6 0
4 years ago
Read 2 more answers
Which phrase describes organisms that formed index fossils?
Vlad1618 [11]

Answer: the first one... are extinct

Explanation:

That's the one that was right

6 0
3 years ago
Read 2 more answers
Insulin and glucagon are hormones, not enzymes, but one promotes production of glycogen, which is how we store glucose in our ce
Elina [12.6K]

Answer:

<h2><u>anabolic</u></h2>

Explanation:

Hope this help

HAVE A NICE DAY!!!

4 0
3 years ago
A bird is flying over a field. What will most likely happen if a toxin causes the
myrzilka [38]

Answer:

B. The bird will stop flying because it will quickly use up its remaining

energy.

Explanation:

This is because the mitochondria is known as the power house of cells. Oxidative phosphorylation takes place in this organelle and it involves the conversion of ADP to ATP through the hydrogen ions(protons).

When the hydrogen ion channel is blocked, energy production in cells stop.

This is why the bird will stop flying as it would have used up its remaining energy and won’t have a new one to use to continue flying.

3 0
3 years ago
Innate responses are contained in an animal s __________.
Alexeev081 [22]
The innate responses that animals have in their system is called as reflex. This can be practiced to perfection depending on your preferred style - whether you want it for defense mechanisms, or even on activities that usually uses the mind. All living creatures have this mechanism. The answer should be B.
8 0
4 years ago
Other questions:
  • When a patient is in the hospital and on oxygen, isnt respiratory therapy supposed to monitor patient?
    11·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • this is the chemical reaction that occurs during photosynthesis; identify which of these is a product in this chemical reaction
    7·1 answer
  • A landforms height above sea level is its elevation,while its relief is the?
    5·1 answer
  • Superantigens produce intense immune responses by stimulating lymphocytes to produce Superantigens produce intense immune respon
    12·1 answer
  • List the biotic components of the carbon cycle
    15·1 answer
  • HURRY BEST ANSWER GETS BRAINLIEST!
    14·2 answers
  • Which of the following statements about a woodland describes a
    10·1 answer
  • Which statement describes a reason that radioactive decay is hazardous?
    15·1 answer
  • Grass is the first member of the ocean food web.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!