1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shutvik [7]
4 years ago
7

Due to the fact that we possess enzymes that break down the alpha linkages in starch, the glucose molecules that make up amylose

and amylopectin are available for humans to absorb. The beta linkage that bonds glucose in dietary fiber products such as cellulose is not available to humans because we do not possess the enzyme capable of breaking down the beta bond.
A. True
B. False
Biology
1 answer:
dedylja [7]4 years ago
7 0

The answer is: A. True

Complex sugars or polysaccharides are composed of basic units called monosaccharides that are linked via  glycosidic bonds. Glycosidic bond is formed through condensation reactions (water is released) that occur between a hydroxyl (OH) oxygen atom on one sugar and the α-anomeric form of C-1 on the other. There are are two types of glycosidic bonds:

- 1,4 alpha ( the OH is below the glucose ring)

- 1,4 beta glycosidic bonds (the OH is above the glucose ring)

Amylase is an enzyme that breaks down starch into smaller glucose molecules, it act on α-1,4-glycosidic bonds and it works in mouth where the digestion begins (salivary amylase) . Maltase breaks down maltose into glucose; sucrase, breaks down sucrose into glucose and fructose; and lactase, which breaks down lactose into glucose and galactose work in small intestine and also act on α-1,4-glycosidic bonds.

You might be interested in
Do my eyes have a faint fold?
cluponka [151]
Yea I guess but it’s not that bad. Cute
7 0
3 years ago
Read 2 more answers
WILL MARK BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!
irga5000 [103]

pretty sure i'm wrong but my guess is that its D because it would make the most sense

7 0
4 years ago
Read 2 more answers
Which of the following is a characteristic of vitamin D nutrition?​a.​Pigments in dark skins increase vitamin D synthesis. b.​On
Anvisha [2.4K]

Answer:

b.​ Only about one-half of the world's population relies on sunlight to maintain adequate vitamin D nutrition  

Explanation:

Dark skin pigments slow down the synthesis of vitamin D, so black people need to spend more time in the sun to absorb enough vitamin D, so the letter A is incorrect.

Prolonged exposure to sunlight degrades the precursor of vitamin D, whereas prolonged exposure to sunlight produces vitamin D3, which acts to regulate heart function and blood pressure.  With this we can conclude that the letter C is also incorrect.

Vitamin D deficiency is not caused by calcium deficiency, on the contrary, vitamin D deficiency is a cause of calcium deficiency. In addition, summer vitamin D synthesis stocks are usually not sufficient to meet summer vitamin D requirements. That is why the letter D is also incorrect.

We can conclude, then, that the correct answer is the letter B. The main source of vitamin production is through sun exposure, because type B ultraviolet rays (UVB) are able to activate the synthesis of this substance. Some foods, especially fatty fish, are sources of vitamin D, but the sun is responsible for 80 to 90% of the vitamin the body receives. It can also be produced in the laboratory and given as a supplement when there is a deficiency and for the prevention and treatment of a variety of diseases.

5 0
3 years ago
Consider this plant cell which organelle is labeled E?
ikadub [295]

I think it's a golgi apparatus but I'm not entirely sure

5 0
3 years ago
Read 2 more answers
Besides race, what other things explain why some people might be more susceptible than others to disease? think about the girl i
madam [21]
The sickness can originate from her predecessors, it's as of now in her qualities. Expires don't have anything to do with races. 
Race and wellbeing allude to the connection between singular wellbeing and one's race and ethnicity. Contrasts in wellbeing status, wellbeing results, future, and numerous different markers of wellbeing in various racial and ethnic gatherings is all around recorded, alluded to as wellbeing abberations. The race is an intricate idea, and the two noteworthy contending speculations of race utilize organic definitions and social development to characterize the racial distinction.
6 0
4 years ago
Other questions:
  • .<br><br> This central organelle in plant cells helps to keep the plant cell turgid:
    15·1 answer
  • Which type of growth can occur only when a population has unlimited resources
    13·2 answers
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Most acid precipitation results from the combination of _____ with water in the atmosphere, forming strong acids that fall with
    6·1 answer
  • What consequence does higher altitude have on people?
    7·1 answer
  • Rudolf Virchow's and Louis Pasteur's work resulted in significant contributions to cell theory but also . . contradicted earlier
    7·2 answers
  • Describe how Mendel cross-fertilized and self-fertilized pea plants.
    8·1 answer
  • A student is asked to design an investigation which will cause an object to have motion that matches the graph she was given.
    10·1 answer
  • Because identical twins begin as a single fertilized egg that then separates, identical twins share ____ percent of genetic make
    13·1 answer
  • Root hair cells do not contain chloroplasts.<br> Suggest one reason
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!