1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksivusya [100]
3 years ago
5

Kara was tested for diabetes. her fasting plasma glucose test showed a level of 120 mg/dl. this indicates that

Biology
1 answer:
Leno4ka [110]3 years ago
4 0
A single test won't put the definitive diagnosis of diabetes. This diagnosis is put on 3 conseccutive measurements and they all have to be more that 125.
You might be interested in
Animals store most of their excess energy reserves as _______ because
Yuri [45]
They store it as adipose tissue because it also provide heat, insulation, and protection.
5 0
3 years ago
Read 2 more answers
Morgan obtains a score on a screening device for depression, which indicates the presence of significant depression. Morgan's ps
Allisa [31]

Answer: Recommend further assessment.

Explanation:

Psychologists can usually tell if you have depression by asking you specific questions and doing a physical exam. Psychologists may, however, ask for lab tests to rule out other diagnoses. They will likely do blood tests to check for medical conditions that may cause depressive symptoms.

8 0
3 years ago
5. Plants use carbon dioxide for the process of
prisoha [69]

Answer:

Plants use carbon dioxide for the process of photosynthesis.

5 0
3 years ago
Read 2 more answers
What type of science does frankenstein learning from agrippa?
kramer
RowseNotessearch

HOMEWORK HELP > FRANKENSTEIN

What sort of science is Victor learning from Agrippa?

print Print

 

document PDF

 

list Cite

EXPERT ANSWERS

LINDA-ALLEN | CERTIFIED EDUCATOR

Cornelius Agrippa (1486-1535) was a German mystic who practiced a "science" that combined alchemy, magic, mysticism, and astrology. Two of his books are Three Books of Occult Philosophy and On Calling Spirits. Through the writing of Agrippa, Frankenstein becomes very interested in alchemy, which is a pseudoscience whose main object is to find a way of turning base metals into gold. You could say that Frankenstein adapted the thinking of the alchemists and instead of transforming other metals into gold attempted to transform a corpse into a living being.

An interesting story about Agrippa concerns sightings of him after his death:

There were rumors that Agrippa had summoned demons on his death bed, and that a black dog roamed the countryside as his familiar. The black dog appears in tales as Faustus, Mephistopheles, and even as a grim in the Harry Potter series.

3 0
3 years ago
Which of the following statements about DNA are true?
Setler [38]

Answer:D

Explanation:

7 0
3 years ago
Other questions:
  • The human respiratory system consists of many different cells, tissues, organs, and organ systems. explain the relationships bet
    8·1 answer
  • As ____________ increases, the two-point threshold decreases. receptor number receptor density receptor sensitivity receptor sen
    8·1 answer
  • What type of bird is this
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The heart is part of the cardiovascular system and is made of cardiac muscle. Cardiac muscle has special characteristics that di
    15·2 answers
  • Help! My little sister need help with her homework question and I have no clue.
    14·2 answers
  • What are some fun and interesting facts about cellular respiration?
    8·1 answer
  • When you place your hand on a hot stove you remove it after a period of time. Then when you are given some morphine, you place y
    11·1 answer
  • Where would you most likely find transform boundaries on an earthquake distribution map?
    9·2 answers
  • Bacterial _____ are at work in the slimy feel of an underwater rock, ear infections, and dental plaque.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!