Observation is broken up into three parts. The first is the date. Then you have the activity and last you have a brief description of what is being observed.
Answer:
C. electricity generation
Explanation:
Introns stands for intervening sequences within a gene.
Explanation:
Introns are the nucleotide sequences within a gene which are intervening but noncoding regions on an RNA transcript which is spliced before the RNA translation to protein
Introns do not code amino acids for protein synthesis. They break the gene sequence in the DNA strand.
The introns form a large chunk and interfere with the protein coding of exons, hence are removed by splicesomes through splicing at the splice junctions.
Improper splicing of introns lead to faulty protein formation
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation: