1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gizmo_the_mogwai [7]
3 years ago
12

How many grams of potassium nitrate (KNO3) would form if 2.25 liters of a 1.50 molar lead nitrate Pb(NO3)2 solution reacts with

1.15 liters of a 2.75 molar potassium chromate K2CrO4 solution? (2 points) Pb(NO3)2 + K2CrO4 yields PbCrO4 + 2KNO3
Biology
2 answers:
nekit [7.7K]3 years ago
7 0
First we must understand the balanced chemical equation:
Pb(NO3)2 + K2CrO4 ==> PbCr04 + 2KNO3

This shows us that two moles of potassium nitrate are formed from 1 mole of lead nitrate or potassium chromate solution. The next step is to find out how many moles of each reactant there are. Note the word Molar is a concentration that simply means moles per liter.

2.25L of 1.5M lead nitrate = 2.25x1.5 = 3.375 moles of lead nitrate
1.15L of 2.75M potassium chromate = 1.15x2.75 = 3.1625 moles

The important part here is to see that the number of moles of the reactants are different. We know the number of moles of products will be dependent on the number of moles of reactants, and in this case there is less potassium chromate than there is lead nitrate, so this is the limiting factor as there is a one to one relationship with both reactants. Therefore, the number of moles of potassium nitrate produced is 2 x number of moles of potassium chromate. i.e. 6.325 moles of potassium nitrate is liberated.

To work out the number of grams, we must find the molar mass (the mass of one mole) of KNO3, which is the sum of the molar mass of each of its component atoms that make up the molecule. I've looked this up as 101.1 grams per mole.

Now we simply times the molar mass by the number of moles to yield the final grams liberated: 6.325 moles  x 101.1 grams/mole = 639.4 grams of potassium nitrate is liberated from this reaction.
qaws [65]3 years ago
4 0

Answer:

639.4

Explanation:

You might be interested in
How do structures and functions of organisms vary in different kingdoms????
Alexxx [7]

Answer:

With millions of different kinds of organisms in the world, scientists must find order in all of this diversity. Scientists group living organisms into one or more of a few major categories as part discipline known as taxonomy. The bodies of organisms are organized into functional systems—cells are organized into tissues, and tissues are organized into organs. Body systems carry out critical functions, such as locomotion, reproduction, digestion, and circulation. All living things on Earth are composed of the same carbon-based, molecular building blocks.

\bf \huge \red{F} \bf \pink{O}\bf \purple{L}\bf \blue{L}\bf \green{O}\bf \red{W} \: \bf \pink{x} \bf \purple{I} \bf \blue{t} \bf \green{z} \bf \red{M} \bf \pink{u} \bf \purple{s} \bf \blue{k} \bf \green{x}

6 0
3 years ago
Synchrony depends on _____. A. attention span B. breast-feeding C. responsiveness and timing D. stable mood
Bumek [7]

Answer:

C. Responsiveness and timing

Explanation:

I just know it, I really don't know how to explain

3 0
3 years ago
Which correctly identifies the location of the asteroid belt?
zhannawk [14.2K]

Answer:

the correct choice is B

located roughly between the orbits of the planets Mars and Jupiter. It is occupied by numerous irregularly shaped bodies called asteroids or minor planets.

4 0
2 years ago
Read 2 more answers
The cladogram shows relationships among several mammal species which group of modern mammals is the most likely closely related
Y_Kistochka [10]
A Rock Hyrax or Rock Rabbit are closely related to elephants As will as Dugong which a species of manatees 
7 0
3 years ago
How does the carbon locked in shells of marine organisms move back to the atmosphere?
puteri [66]

Most of the carbon that's stored in plants - and in anything that eats them - is released back into the atmosphere by respiration when the organisms die and are eaten by microbes.

The answer is B

3 0
2 years ago
Other questions:
  • Which organelle is like the brain of the cell
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the name of a longitudinal body wave that travels through gasses liquids and solids easily
    5·1 answer
  • Why does thunder always accompany lightning?
    8·2 answers
  • BRAINLIEST IF CORRECT I NEED HELP FOR BETTER GRADES 65 POINTS
    7·1 answer
  • 20 points
    7·1 answer
  • The vegetation in a region is removed in an area so that electrical lines from a new power plant can be built. What is a likely
    13·1 answer
  • What causes our seasons?
    9·2 answers
  • Name
    12·2 answers
  • What happens to water and dissolved minerals after they move across the epidermis of a root
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!