1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lorasvet [3.4K]
3 years ago
10

Which is not a process involved in the formation of sedimentary rock? compaction deposition extrusion weathering

Biology
2 answers:
elena-s [515]3 years ago
8 0

Extrusion is NOT a process involved in the formation of sedimentary rock.

<h2>Further Explanation</h2><h3>Sedimentary rocks </h3>
  • Sedimentary rocks are types of rocks that are formed through accumulation of sediments at low temperatures in tectonic layers and sinks. These sediments includes; pebbles, shells, sand and other material fragments.  
  • The sediments accumulates in layers and then harden into rocks over a period of time.
  • Examples of sedimentary rocks include; limestone and conglomerate
  • There are five basic steps involved in the formation of sedimentary rocks:
  1. Weathering (making the sediment by breaking down or dissolving preexisting rocks or living organisms)
  2. Erosion (picking up the sediment by water, wind, or glaciers)
  3. Transportation (moving the sediment by water, wind, or glaciers)
  4. Deposition (depositing the sediment)
  5. Lithification (turning the sediment to rock).
<h3>Other types of rocks</h3><h3>Metamorphic rocks</h3>
  • These are types of rocks that are formed as a result of changes that occurs due to intense heat and pressure under the surface of the earth. They result from action of heat and pressure on other rocks that pre-existed.
  • These types of rocks are characterized by shiny crystals, ribbon-like layers among other features.
  • Examples of metamorphic rocks are marble and gneiss
<h3>Igneous rocks </h3>
  • These are types of rocks that are formed as a result hardening and cooling of magma from volcanic eruptions. Magma may cool inside the earth or when on the surface of the earth as a result of volcanic eruptions. The lava from this eruptions cools and hardens to form metamorphic rocks.
  • Igneous rocks are glass-like and shiny with no crystals. They may also have tiny spaces and holes due to gas bubbles trapped during the cooling process.
  • Examples of igneous rocks include obsidian and basalt.
  • The three types of rocks may be further classified in terms of chemical composition, texture and formation.

Key words: Rocks, sedimentary rocks

<h3>Learn more about;</h3>
  • Rocks and rock types; brainly.com/question/2817889
  • sedimentary rocks; brainly.com/question/28178895
  • igneous rocks; brainly.com/question/2817889
  • metamorphic rocks; brainly.com/question/2817889

Level; High school

Subject: Geography

Topic:  Rocks

sub-topic: Sedimentary rocks

NemiM [27]3 years ago
5 0
Extrusion <span>is not a process involved in the formation of sedimentary rock</span>
You might be interested in
Pls help <br> a. 5 <br> b. 4 <br> c. 6 <br> d. 3<br> e. 1
sergejj [24]

Answer:

c

Explanation:

6 0
3 years ago
Suppose that rat liver expresses a protein called Yorfavase. This enzyme is composed of 192 amino acid residues, and thus the co
irakobra [83]

Answer:

Centromeric DNA

Explanation:

Genes are responsible for formation of proteins. A codon produces a single amino acid and it comprises of three base pairs. The whole DNA of organism does not contribute to encode protein. There are sequences in DNA that does not contribute in coding known as non-coding DNA and perform different functions. These may include the O O O 5-end, DNA coding for a signal sequence, noncoding intron and O promoter sequence .

The centromere is the part of DNA that links the sister chromatids. The centromere is not converted to mRNA or proteins.  It is also not involved in regulation of genes. So it did not contribute to 864 bp found in the yfg gene.

6 0
4 years ago
compare and contrast the different types of heterotrophs Use the terms Carnivore, herbivore, and omnivore in your discussion to
Lunna [17]

Answer:

I'm not sure if your asking about a A, B, C, D question but, as far as I can tell this is what I know

Explanation:

(:Comparing:) Heterotrophs occupy the second and third levels in a food chain, a sequence of organisms that provide energy and nutrients for other organisms. ... Herbivores—organisms that eat plants—occupy the second level. Carnivores (organisms that eat meat) and omnivores (organisms that eat plants and meat) occupy the third level.

(:Contrasting:) Examples include plants, algae, and some types of bacteria. Heterotrophs are known as consumers because they consume producers or other consumers. ... Herbivores—organisms that eat plants—occupy the second level. Carnivores (organisms that eat meat) and omnivores (organisms that eat plants and meat) occupy the third level.

Hope this helps.

5 0
3 years ago
Scientists use a ______ to detect and study earthquake waves. Two types of Earthquake waves that travel through Earth’s interior
alexandr402 [8]

Answer:semestic waves and surface waves

Explanation:

3 0
3 years ago
Read 2 more answers
Cells are the basic units of life.
viva [34]
I think it's D. Sry if you get it wrong though
8 0
3 years ago
Other questions:
  • All cells are surrounded by a membrane. which is a characteristic of a cell membrane
    14·1 answer
  • What happens in metaphase 1 in meiosis
    5·2 answers
  • In general, life needs to maintain a pH level between____.<br> 0)1-4<br> 0)5-8<br> 0)9-14
    10·1 answer
  • What is an advantage of using transgenic bacteria to produce human proteins?
    10·1 answer
  • We should be taking every step we can to protect our health. Getting vaccinated against bacterial meningitis will help protect o
    8·1 answer
  • List two natural disturbances and two human-made disturbances that can lead to succession
    9·1 answer
  • Although the process of translation is similar in bacteria and eukaryotes
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Please help will give brainliest no links please
    7·1 answer
  • Life takes place in populations, and the size of a population can increase, decrease, or remain the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!