Answer:
D. .................................
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
In gram positive bacteria have a peptidoglycan layer outside of the cell wall. Gram negative bacteria have peptidoglycan between membranes.
The natural penicillin have activity against non beta lactamase producing gram - positive cocci, which includes such as - viridans streptococci, anaerobic streptococcus. Penicillin work indirectly bursting bacteria cell walls. It kills bacteria through binding of that betalactum ring.
Gram positive bacteria have a much thicker layer of peptidoglycan and lack of the protection of an outer membrane. This class , penicillin was first antibiotic to be used widely and prevents the final cross linking step. There are some more classes of penicillin like- natural , penicillin-stable, aminopenicillins and extended-spectrum penicillin.
To learn more about gram positive bacteria here
brainly.com/question/13794411
#SPJ4
The thermosphere keeps the earth from getting to hot frame the sun and it's the last layer so
the thermosphere
