The answer is (B. Medium) because it has to travel through the ear drum evenly without busting it. Hope this helped :)
Answer:
The circulatory system to provide this oxygen and to remove the waste products of metabolism.The exchange of gases between the blood and tissue cells is internal respiration.
Explanation:
the circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles
hope this helps
Light waves are part of the _electromagnetic spectrum. _
remember that the whole E.M. Spectrum includes various "types of light" > Infrared, (Visible) Light, and UV Light.
_Brainliest if helped!
Answer:
C: Earth scooped out that can form a lake or deep valley
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
