Typhitis, also called neutropenic enterocolitis, is an infection that often develops in cancer patients who undergo chemotherapy. In many cases, surgical intervention is required.
Without surgical intervention, the patient would be transferred to an ICU (Intensive Care Unit) for monitoring, and the nurse would perform some or all of these emergency actions:
1. Bowel rest and nasogastric suction,
2. Serial abdominal examinations,
3. Providing intravenous fluids, blood, and platelet transfusions when needed,
4. Using antibiotics to fight the infection, and obtaining cultures to determine if the antibiotic is working,
5. Not administering medication that could worsen the situation.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The struggle for the civil rights
Explanation:
because the mom must be either brown your white and the dad must be the other color
It’s cool that you found that! You can try identifying it by its luster, color, breakage, etc, Try getting a piece of paper or something, scrap it on the paper, and see what it leaves behind. That’s a way many scientists identify rocks/crystals. You can also google types of rocks and see if you find a match. You always need to look at its color, as the color is the most distinctive feature of a rock. If you’ve since all of these things and your very serious about it, you can try calling somewhere or someone who would know (like a scientist who studies rocks).
