1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mice21 [21]
3 years ago
15

Which of the following is not a nucleotide? GTP ATP RNA CAMP​

Biology
1 answer:
timama [110]3 years ago
8 0

the following is not a nucleotide is RNA

You might be interested in
Willful muscle contraction; emotions
777dan777 [17]
Its the frontal lobe. :)
8 0
3 years ago
ATP is called the energy currency of the cell because
VikaD [51]
D. Most of the energy that drives metabolism is supplied by ATP
5 0
3 years ago
Read 2 more answers
when you open a solid room air fresher the solid slowly loses mass and volume. how do you think this happens
LenKa [72]
Because the air freshener is being released out in to open, so it spreads everywhere.
Hope that helps :)
8 0
3 years ago
Alizarin yellow is a pH indicator that transitions from red to yellow when the pH falls from a value of 11 to below 10. Why is p
nydimaria [60]

Answer:

The correct answer is - acidic conditions wouldn't trigger a change in the color of Alizarin yellow.

Explanation:

The growth of E. coli generally occurs at neutral pH, however, its growth is normal at acidic conditions as well.  The change in the growth of  E. coli is not able to detect by alizarin.

The phenol red turns yellow in the presence of an acid, and the change in pH in an alkaline environment can be detected by the red color of phenol red. Growth of E.coli will grow in pH of 10-12 . But, very slowly. The color change in alizarin is also apparent at pH 10.2 to 12 only.

7 0
3 years ago
A student wants to see how temperature affects the
Afina-wow [57]

Answer:

The answer is c, your welcome;)

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • As much as 25 percent of the fruits and vegetables grown in Chinese agricultural regions rot before they can be transported the
    7·1 answer
  • Nerve tissue can be found in
    14·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Which class of vertebrates is considered to be the first to develop lungs, allowing them to become terrestrial organisms?
    7·1 answer
  • After observing the F2F2 generation, what conclusion did Mendel come to?
    7·1 answer
  • B. Why is there a huge demand of professionals in the field of agriculture​
    14·1 answer
  • Which is a basic characteristic of all living cells?
    7·2 answers
  • 3419059779 ppppppppppppp1234​
    13·2 answers
  • Plant and animal cells are complex and contain many structures.<br><br> a. True<br> b. False
    12·1 answer
  • Which of the following require a host cell because they are not able to make protein on their own?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!