1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
9

En que lugar se efectúa la fecundación interna

Biology
1 answer:
yawa3891 [41]3 years ago
5 0
<u><em>Graneros y patios son el lugar perfecto para fertilizar cultivos.</em></u>
You might be interested in
Siderophores are bacterial proteins that compete with the host's:______.a. antibodies. b. iron-transport proteins. c. white bloo
joja [24]

Answer:

The correct answer is iron-transport proteins

Explanation:

Siderophores are proteins produced by bacteria, and compete with the host's iron-transport proteins. They aim to bind and "hijack" the host's cell iron molecules for their own pathogenic cell processes

8 0
3 years ago
What is the difference between type A and type B blood?
dangina [55]
It is very easy and simple difference that is antigens and antibodies .
it can be different due to donor and recipient also .
A type blood having antigens
whereas B type blood having nil.

B type blood having antibodies
whereas A type blood having nil.


4 0
3 years ago
Explain how natural forces and human effects affect the observed global temperature (black line) in graph 2. Is solar radiation
Anon25 [30]

Answer:

Natural forces don’t have a strong effect on recent global temperatures. The natural forces line begins to drop around 1950 and does not track with the observed temperature line. On the other hand, the human effects line rises upward with the observed temperatures, so it’s a stronger effect. Solar radiation falls into the category of natural forces.

Explanation: This is the exact answer so I recommend changing it up a little bit. :)

6 0
3 years ago
Read 2 more answers
In a given strand of dna the number of thymines
yarga [219]
D. Same as the number of adenines


Thymine and Adenine will always pair together


:)
3 0
3 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
3 years ago
Other questions:
  • Hi. I'm studying and there is just one question I am not sure of the answer of on my study guide. I believe it is either A or C
    14·2 answers
  • How does the gray whale fit into the food web?
    7·1 answer
  • A cross was made between two strains of plants that are agriculturally important. One strain was disease-resistant but herbicide
    8·1 answer
  • This is the reproductive part of the plant and it produces seeds and develops the fruit.
    8·1 answer
  • Selective permeability in a sentence
    13·1 answer
  • Ways to study the past climates of earth
    5·1 answer
  • Jim is in a crowd of people at the mall looking for his girlfriend Tammy, who was supposed to meet him for dinner. Jim realizes
    15·1 answer
  • I need help please could someone
    5·1 answer
  • In plants, what is the function of the xylem?
    6·1 answer
  • A DNA segment in a somatic cell undergoes the mutation shown;
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!