Answer:
The answer is true.
Explanation:
Cuz that water be nasty.
Brainliest would be really really awesome!!!
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer: The sensual aspect of intercourse became more important.
Explanation:
There are different development stages in humans; from infant to adolescent to adulthood. The word "When humans begins to walk upright' shows the development stage of maturity. This usually takes place in adolescents. The sensual aspect of intercourse became more important. Sex is one of the drives that is behind every thought, feeling, and behavior.
Answer:
water is unable to evaporate from the soil