1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TEA [102]
3 years ago
10

A cell must expend energy to transport substance using

Biology
1 answer:
Dafna11 [192]3 years ago
8 0
The cell will use Endocytosis
You might be interested in
Which phase requires the longest time for completion?
Pie

Answer:

interphase

Explanation:

6 0
3 years ago
Help please someone please what is the answer
Rasek [7]

Answer:

The answer is true.

Explanation:

Cuz that water be nasty.

Brainliest would be really really awesome!!!

5 0
3 years ago
Read 2 more answers
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
Hatshy [7]

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

4 0
3 years ago
Read 2 more answers
When humans began to walk upright, how did sexuality change? Group of answer choices
patriot [66]

Answer: The sensual aspect of intercourse became more important.

Explanation:

There are different development stages in humans; from infant to adolescent to adulthood. The word "When humans begins to walk upright' shows the development stage of maturity. This usually takes place in adolescents. The sensual aspect of intercourse became more important. Sex is one of the drives that is behind every thought, feeling, and behavior.

7 0
3 years ago
Tai grows plants in a container called a terrarium, as shown below. He keeps the terrarium on a sunny windowsill.
Nina [5.8K]

Answer:

water is unable to evaporate from the soil

8 0
3 years ago
Other questions:
  • Help, please<br><br> 14. How does the camouflage of a butterfly’s cocoon relates to function
    13·2 answers
  • Sexual reproduction includes a reproductive pattern called _____.
    7·1 answer
  • Continuous cell lines differ from primary cell lines in that
    5·1 answer
  • The law of ___ b elps explain why the density of air as the altitude above earth's surface increases
    7·2 answers
  • Biologists notice that a population of ferrets introduced into a reserve begins to show exponential growth. The figures represen
    14·1 answer
  • What is the main function of digestion?
    8·2 answers
  • What have a jellylike material found throughout cell?
    5·1 answer
  • how can scientists accurately compare atmospheric composition today with atmospheric composition thousands of years ago?
    6·1 answer
  • Meteorologists often try to predict what the high temperature of a day will be several days beforehand. Why do meteorologists no
    6·1 answer
  • Where do daughter cells come from
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!