1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
postnew [5]
3 years ago
5

Using the diagram, which of the structures is the oldest? H F M B

Biology
1 answer:
Anna35 [415]3 years ago
6 0
I would say B so yea...hope ur day doing well
You might be interested in
Explain how a person can be a carrier for a sex-linked disorder, but not exhibit this disorder.
Pachacha [2.7K]
It comes down to genes it can be passed down from family
4 0
3 years ago
Which is an interconnection of food chains in an ecosystem?
Musya8 [376]
A food chain is a linear sequence of organisms through which nutrients and energy pass as one organism eats another. ... Food webs consist of many interconnected food chains and are more realistic representation of consumption relationships in ecosystems.
4 0
4 years ago
The _____ zone is where light can penetrate
nikdorinn [45]

Answer:

The upper 200 meters (656 feet) of the ocean is called the euphotic, or "sunlight," zone. This zone contains the vast majority of commercial fisheries and is home to many protected marine mammals and sea turtles. Only a small amount of light penetrates beyond this depth.

Explanation:

it is called the euphotic or sunlight but either one of them answer are showing so I'm thinking (NONE OF THE ABOVE )

8 0
3 years ago
How would you classify paramecium: animal-like, plant-like or fungus-like and why?
zvonat [6]
Happy Birthday to you, Happy Birthday to you, Happy Birthday dear Alicia, Happy Birthday to you!!!
3 0
3 years ago
Read 2 more answers
If the greenhouse effect were to completely disappear, what would happen to earth?
dexar [7]

The greenhouse effect is necessary to explain why weather occurs. The climate of the Earth is greatly affected by two opposing processes: the greenhouse effect and atmospheric convection. The greenhouse effect is acting to warm the lower atmosphere and cool the upper atmosphere while the atmospheric convention (composed of thermals, clouds, precipitation) is cooling the lower atmosphere and warms the upper atmosphere). <span>The greenhouse effect warms the Earth’s surface, but very few people are aware that weather processes greatly limit that warming.<span> In the absence of greenhouse effect, the Earth will be left without weather.</span></span>

8 0
3 years ago
Other questions:
  • What drug type is most likely to cause respiratory depression and myxedema coma in clients with thyroid disorders?
    12·1 answer
  • A gamete from a human female contains _______. a gamete from a human female contains _______. 23 autosomes and a y chromosome 23
    15·1 answer
  • What is the term of ecological relationship?
    13·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Nucleic Acids functions /short answer
    11·1 answer
  • A camel has a hump to store water so it can survive in its desert environment. which kind of adaptation is this?
    5·2 answers
  • A baked potato has 140 calories and bag of chips 270 Cal which has more energy?​
    10·1 answer
  • Please look at the picture to answer and there is the answer options! ASAP
    7·1 answer
  • How does energy get from one organism to another?
    15·2 answers
  • 3 to 5 sentences, describe the relationship between a glucose molecule and the products it makes during cellular respiration.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!