Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Your answer is "Hydropower uses the kinetic energy of water to generate electricity"
The stem of the plant should be cut at least three to four centimeters above the surface level.
The stem should be tightly fixed into the glass capillary.
All connection should be made air-tight by using paraffin.
Initial and final readings should be carefully noted.
Antigens<span> are foreign particles, usually proteins, which are capable of generating an immune response in the body, a property known as immunogenicity. This immune response consists of specific </span>antibodies<span> which are generated by plasma cells as a result of exposure to a specific epitope presented by the </span>antigen<span>.</span>
