1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
14

Watson and Crick's model of DNA replication is called

Biology
1 answer:
alex41 [277]3 years ago
8 0

Answer:

(B) semiconservative.  

Explanation:

According to the model proposed by Watson and Crick, the DNA molecule consists of two polynucleotide chains arranged on a helix around an imaginary axis, rotating to the right (a double helix). That is, the DNA molecule is in the shape of a spiral staircase, in which the "steps" are made up of nucleotide nitrogen bases and the "handrails" are covalently linked phosphate and sugar - so it is said that DNA is shaped like a helical ribbon. Also according to Watson and Crick DNA replication is semi-conservative, because each strand of DNA will give rise to another strand that will be complementary to its nucleotides.

You might be interested in
A colleague gives you two tubes containing membrane fractions from an animal cell lysate. One tube contains the plasma membrane
OLga [1]

Answer:

B) a higher protein to lipid ratio.

Explanation:

The cell membrane of eukaryotes is known to be a phospholipid bilayer with embedded proteins.  This implies that the first tube will contain a higher amount of lipids.

The membrane of the mitochondria is slightly different from the cell membrane in which its protein to lipid ratio is higher, containing a large number of integral proteins.

6 0
3 years ago
Wirte 2 slogans on 'need to conserve nature? ​
natima [27]

Answer:

Tree planting is the safest solution to pollution. Save the earth, save our environment. Don't be cruel, conserve your fuel.

5 0
3 years ago
Read 2 more answers
Which of the following could be found on either public or private land?
Reptile [31]
<span>The option that could be found on either public or private land is C. mine. A state park can only be found on public land, because parks are owned by states, not regular people. A single-family residence is only found on private land, because that is a house that a family owns. A factory is on private land only, because it belongs to a person or another company. Which leaves us with mines, that can be found both on private and public lands.</span>
5 0
3 years ago
Read 2 more answers
What is another way genetic variation increase in a population?
Tcecarenko [31]

Answer: The flow of individuals in and out of a population introduces new alleles and increases genetic variation within that population. Mutations are changes to an organism’s DNA that create diversity within a population by introducing new alleles.

Explanation:

5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • What enzyme is coded for in the chromosome of bacteria
    14·2 answers
  • A population of rabbits follows the typical pattern of inheritance and the law of dominance for fur color. B is the allele for b
    14·2 answers
  • Which statement describes elements?
    13·1 answer
  • What is the correct sequence of these events, from earliest to most recent, in the evolution of life on Earth?origin of mitochon
    10·1 answer
  • Which one of these lifestyle factors has most contributed to climate change?
    10·1 answer
  • What is an Atom in Biology​
    11·2 answers
  • Question is in the picture, easy question I’m just dumb enough to not figure it out
    6·2 answers
  • The part of the neuron that takes information away from the cell body is called an
    5·1 answer
  • Tell me something interesting about protozoa (at least 5 facts) <br> make it simple
    9·2 answers
  • Please help lolololol
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!