1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
12

Zoe wants to replace the letters on her diagram with labels that describe how the nerves and muscles communicated with each othe

r to trigger her reflexive response. What should her labels be? Should she eliminate any letters from this pathway?

Biology
2 answers:
Jet001 [13]3 years ago
6 0

Hello. This question is incomplete. You forgot to attach the image that completes the question.

The image is attached below:

Answer:

A- Sensory Neuron

B- Spinal cord

C- Effector neuron

D - Brain

Explanation:

  1. Sensory neuron: Its main function is to allow the reception of stimuli that are transformed into nervous impulses and electrical signals, capable of realizing sensations, such as a peliscão, for example. These impulses are transmitted to the spinal cord.
  2. Spinal cord: The main function is to support the body in an upright and vertical position. It also has the function of transmitting electrical signals and nerve impulses between some parts of the body and the brain.
  3. Effector neuron: Its main function is to receive muscle stimuli capable of creating muscle contractions. These neurons are located in the spinal cord.
  4. Brain: the processing center receives all the stimuli sent by the bone marrow. Its main function, in this case, is to produce bodily responses to the stimuli it has received, producing muscle movement.

Alexeev081 [22]3 years ago
4 0

Answer:

A: skin detects sharp nerve

B: spinal cord receives signal from sensory

C: the nerve impulse the muscle to contract

Zoe should remove the the brain from this pathway because a reflexive motor response doesn’t travel to the brain.

Explanation:

You might be interested in
Carrying capacity is _____.
ser-zykov [4K]
The amount of stuff that an ecosystem
5 0
4 years ago
Which type of molecule that can be found in living things lack carbon atom​
Georgia [21]

water molecule is one of few molecule that lack carbon atom

h2o

8 0
3 years ago
Read 2 more answers
Approximately+________%+of+the+stored+energy+of+an+organism+at+one+level+of+a+food+web+is+transferred+to+the+tissues+of+the+orga
Mademuasel [1]

Approximately  10% of the stored energy of  an organism at  one level of a food web is transferred to the tissue of the organism that consumes it at the next level of the food web.

<h3>What is food web and its importance ?</h3>

A food web consists of all the food chains in a single ecosystem. Each living thing in an ecosystem is a part multiple food chains. The importance of food webs is to describe feeding relationship among species in a community.

On an average only about 10 percent of energy stored as biomass in a trophic level is passed from one level to the next.

to learn more about Food web click here

brainly.com/question/2233704

#SPJ4

3 0
2 years ago
In order to determine if individuals from separate populations are indeed distinct species, Drosophila biologists often test to
faust18 [17]

Answer:

Biological species contest.

Explanation:

Different species concept are introduced to describe the exact definition and classification of species. Some species concept are biological species contest, morphological species concept and ecological species contest.

According to biological species contest, the group of individual that can breed among themselves and not with the other group. Here, the Drosophila species has been classified by the biologist depending on their mating ability to their group of individual only.

Thus, the answer is biological species contest.

6 0
3 years ago
Human overpopulation will likely lead to more extinctions of species because
kherson [118]
D.habits will be altered
7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the purpose of translation?
    13·1 answer
  • George believes that rotting garbage can turn into maggots that grow up to be flies. Use a principle from cell theory to explain
    9·1 answer
  • Why is biomass considered a renewable resource?
    13·2 answers
  • Which is the central element for all living things
    12·1 answer
  • What can scientists accomplish by applying recombinant-DNA technology?
    8·2 answers
  • Que componentes tienen los jabones líquidos?☹​
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • If an organism didn't have DNA, it would be missing which sign of life?
    15·1 answer
  • 2. What term describes the formation of water droplets on the outside of a glass of cold water on a hot day?
    12·1 answer
  • If pathogen A is more resistant to an erythromycin disc on a Kirby-Bauer plate compared to pathogen B, then pathogen A will have
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!