1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
12

Zoe wants to replace the letters on her diagram with labels that describe how the nerves and muscles communicated with each othe

r to trigger her reflexive response. What should her labels be? Should she eliminate any letters from this pathway?

Biology
2 answers:
Jet001 [13]3 years ago
6 0

Hello. This question is incomplete. You forgot to attach the image that completes the question.

The image is attached below:

Answer:

A- Sensory Neuron

B- Spinal cord

C- Effector neuron

D - Brain

Explanation:

  1. Sensory neuron: Its main function is to allow the reception of stimuli that are transformed into nervous impulses and electrical signals, capable of realizing sensations, such as a peliscão, for example. These impulses are transmitted to the spinal cord.
  2. Spinal cord: The main function is to support the body in an upright and vertical position. It also has the function of transmitting electrical signals and nerve impulses between some parts of the body and the brain.
  3. Effector neuron: Its main function is to receive muscle stimuli capable of creating muscle contractions. These neurons are located in the spinal cord.
  4. Brain: the processing center receives all the stimuli sent by the bone marrow. Its main function, in this case, is to produce bodily responses to the stimuli it has received, producing muscle movement.

Alexeev081 [22]3 years ago
4 0

Answer:

A: skin detects sharp nerve

B: spinal cord receives signal from sensory

C: the nerve impulse the muscle to contract

Zoe should remove the the brain from this pathway because a reflexive motor response doesn’t travel to the brain.

Explanation:

You might be interested in
What evidence is there for evolution?
jarptica [38.1K]

The evidence would be all the different types of species

5 0
3 years ago
Why does natural selection act on the phenotypes rather than the genotype of an organism?
o-na [289]
This is why natural selection acts on phenotypes instead of genotypes. A phenotype is an organism's physical traits, while a genotype is an organism's genetic makeup. This may sound counter-intuitive since the genetic makeup does get<span> passed on from generation to generation through reproduction.</span>
5 0
3 years ago
Which best explains why a pyramid is used to represent energy flow within an
Nat2105 [25]

Answer:

The answer is A

Explanation:

Because available energy decreases as you go up

5 0
3 years ago
Read 2 more answers
The snowshoe rabbit has unusually large hind feet. This adaptation helps the snowshoe rabbit A) move quickly. B) fight off preda
pav-90 [236]

Answer: <u>Option C, stay on the top of the snow </u>

Explanation: Animals have physical features which help them survive in their habitats, protect them from predators and even face adverse weather conditions. Some adaptations are according to the easy movement of the animals. For example- snowshoe rabbits have bigger feet so that they can jump on the top of the snow without digging into it.

6 0
3 years ago
Read 2 more answers
How does CO2 level affect oxygen production?
Elina [12.6K]

Answer:

Grupa chemików z Uniwersytetu Środkowej Florydy pod kierownictwem profesora Fernando Uribe-Romo, odkryła sposób zamiany dwutlenku węgla w paliwo i tlen — naśladując naturalne procesy w jakich rośliny konsumują CO2, czyli fotosyntezę, która z dwutlenku węgla i wody produkuje węglowodany czyli paliwo dla organizmów żywych.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is expected to increase due to change climate
    6·2 answers
  • A male rabbit with genotype GgBb x with a female rabbit with genotype ggbb. Set up the Punnett square and determine the expected
    6·1 answer
  • Look at the diagram How many peaks are on this shield volcano?
    15·1 answer
  • Which organelle will assist the synthesis of globulin?
    14·1 answer
  • What conclusion about the bacteria domain could be made from the phlyogenetic tree below?
    10·1 answer
  • Which one is the best definition of an ecosystem
    8·1 answer
  • List different causes of diseases​
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What is the waste material liquid that is formed in the kidneys? _____
    15·2 answers
  • How can you tell which side of the heart is the anterior surface and which side is the posterior surface
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!