Coat color in one breed of mice is controlled by incompletely dominant alleles so that yellow and white are homozygous, while cream is heterozygous. Thecross of two cream individuals will produce <span><u>equal numbers of white and yellow mice, with twice as many creams as the other two colors.</u></span>
<span>If cancer, stroke, and heart disease were eliminated, demographers estimate that the life of an average 70-year-old would be extended approximately 7 years.It is because these are the major diseases that target the middle aged people.If these are eliminated people would be more heslthy and enjoy a longer life span</span>
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
This is more of an answer based off of knowledge than fact, but i believe its that "New ideas often develop from unsuccessful experimentation."
Answer:
B
Explanation:
i asked my Alexa... it was a good question
