1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skad [1K]
2 years ago
13

In a abimal cell where would you expect to find an abundance of mitochondria

Biology
1 answer:
just olya [345]2 years ago
6 0

They are located in the cytoplasm. I don't really know how else to answer the question.

Hope this helps

You might be interested in
How are these four types of protists similar to animals? how are they different?
Marizza181 [45]
Oklololololololololololololololol
6 0
3 years ago
Why does ethanol becomes cloudy/white when testing fat
ki77a [65]

Answer:

Ethanol is known as a fat solvent, and the cloudy or white color that it acquires when testing fat is due to the fact that this test includes the addition of water, forming an emulsion.

Explanation:

<u>The emulsion test for fats</u> is a test used to show the presence of these in some substances or foods.

Under normal conditions, fats are miscible - they can be dissolved - in ethanol, an alcohol, but not in water.

This test consists of dissolving the substance to be tested in ethanol, and then adding water. The principle by which the emulsion test is governed is that ethanol allows a certain amount of fat to dissolve in water, forming a cloudy or whitish emulsion.

Learn more:

Differences between emulsion and solution brainly.com/question/6677364

4 0
3 years ago
What direction does rna polymerase synthesize rna?
Mamont248 [21]

Answer:RNA polymerase synthesizes an RNA transcript complementary to the DNA template strand in the 5' to 3' direction. It moves forward along the template strand in the 3' to 5' direction, opening the DNA double helix as it goes.

Explanation:

5 0
2 years ago
The snowshoe hare has two distinct coat patterns for different seasons of the snowy tundra habitat. Which statement describes ho
alexdok [17]
I think the answer is B
8 0
2 years ago
Read 2 more answers
Why are bacteria and decomposers necessary for nature natural cycles
katen-ka-za [31]

Because bacteria can be good for the environment

6 0
3 years ago
Other questions:
  • List three specific functions of capsules.
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is the best answer
    12·1 answer
  • Given the relationships identified above, determine what would happen to the populations under the following circumstances. If t
    6·2 answers
  • The physical characteristics of an organism that result from its genes are referred to as its
    15·1 answer
  • Hialeah is a tornado-prone area in Florida.
    14·2 answers
  • Give an example of a topic a biologist might study
    8·1 answer
  • Human blood has four basic parts. Which part is matched with the correct function?
    5·2 answers
  • ....... bacteria as in absence of air​
    15·1 answer
  • How can the ethiopian wolves prey be classified as.<br><br> Dont say endangered plz
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!