1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuki888 [10]
3 years ago
9

About 70% of the human population can taste the bitter chemical phenylthiocarbamide (PTC), which is found in foods like broccoli

. The allele, T, for tasting PTC is dominant over the allele, t, for not tasting it. Calculate the allele frequencies using the Hardy-Weinberg equation, where p represents the dominant allele frequency, and represents the recessive allele frequency. Which of the following is closest to your results?
A. p = 0.45; q = 0.55
B. p = 0.84;q0.55
C. p = 0.70;q=0.30
D. p = 0.84; q = 0.16
Biology
2 answers:
dmitriy555 [2]3 years ago
8 0

Answer:

p = 0.45; q = 0.55

Explanation:

nignag [31]3 years ago
5 0

Answer:

c

Explanation:

You might be interested in
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Which type of biomolecule are the enzymes that carry out DNA replication? the choices are Carbohydrates Lipids Proteins Nucleic
ollegr [7]

Answer:

Nucleic Acid

Explanation:

6 0
2 years ago
Read 2 more answers
What type of cells are created in the cell cycle and mitosis?
rewona [7]

Answer:

Mitosis produces new cells, and replaces cells that are old, lost or damaged. In mitosis a cell divides to form two identical daughter cells.

Explanation:

i got my answer from go0gle _-_

7 0
2 years ago
Read 2 more answers
Nothing is exempt from ________, which states the total energy remains constant during a physical change.
OLEGan [10]
Newton's Law of Motion
6 0
3 years ago
Read 2 more answers
_____________________, commonly known as sea squirts, have a larval stage that resembles a chordate.
svetlana [45]

Urochordates, commonly known as sea squirts have a larval stage that resembles a chordate.

What are Urochordates? Give the characteristics of it.

Ascidians (sea squirts) are a common term for the Urochordata, also known as the Tunicata. The body of an adult tunicate is fairly simple. While possessing all the characteristics of a chordate, including a notochord, a dorsal nerve cord, pharyngeal slits, and the larva of many tunicates swims freely and lacks only these characteristics. Ascidia, Salpa, and Doliolum, for instance.

Characteristics features of Urochordata:

1. The grownups are anchored to the foundation.

2. It is also known as "Tunicate" because an adult's body is covered by a tunic formed of tunicin, a cellulose-like substance.

3. The notochord only appears in the larval stage and vanishes in the adult.

4. In adults, a dorsal ganglion takes the role of the nerve cord that is present in the larva.

5. The larva can migrate and changes into a different animal.

Learn more about Urochordata here:

brainly.com/question/1186221

#SPJ4

3 0
2 years ago
Other questions:
  • Know anything about genetics.....
    10·2 answers
  • What micromolecules are broken down in the stomatch?
    12·1 answer
  • Photosynthesis is important to living organisms because it is the foundation of most food chains. the source of nitrogen gas in
    13·2 answers
  • What body systems do you use when playing the flute?
    5·1 answer
  • Diffusion and osmosis are forms of passive transport.
    10·1 answer
  • Put the following list in order from beginning to end of a food chain.
    5·2 answers
  • Is it possible for energy to be transferred directly from the first trophic level to the third trophic level? Explain.​
    7·1 answer
  • Iron rich deposits that formed about 2 billion years ago have red layers. Layers formed before then were not red. The red layers
    5·1 answer
  • Structures represented in the illustration below are found in the lower epidermis of a plant leaf. The illustration shows the re
    6·1 answer
  • Which of the following correctly defines sustainability?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!