1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Which safe practice is part of using aseptic technique?using a safety shower to wash chemicals off skin and clothingwearing prot
Soloha48 [4]
It would be to wear protective clothing and gloves when transferring bacteria and fungi
3 0
3 years ago
Read 2 more answers
Describe the phases of the cell cycle. be sure to include the name of each phase and what is occurring within the cell during ea
julsineya [31]

Actively dividing eukaryote cells pass through a series of stages known collectively as the cell cycle: two gap phases (G1 and G2); an S (for synthesis) phase, in which the genetic material is duplicated; and an M phase, in which mitosis partitions the genetic material and the cell divides.

 

<span><span>G1 phase. Metabolic changes prepare the cell for division. At a certain point - the restriction point - the cell is committed to division and moves into the S phase.</span><span>S phase. DNA synthesis replicates the genetic material. Each chromosome now consists of two sister chromatids.</span><span>G2 phase. Metabolic changes assemble the cytoplasmic materials necessary for mitosis and cytokinesis.</span><span>M phase. A nuclear division (mitosis) followed by a cell division (cytokinesis).</span></span>

The period between mitotic divisions - that is, G1, S and G2 - is known as interphase.

<span>Mitosis is a form of eukaryotic cell division that produces two daughter cells with the same genetic component as the parent cell. Chromosomes replicated during the S phase are divided in such a way as to ensure that each daughter cell receives a copy of every chromosome. In actively dividing animal cells, the whole process takes about one hour.</span>

7 0
3 years ago
Select the Nuclear membrane closeup. How is the nuclear membrane similar to the cell membrane? Select the Nuclear membrane close
vova2212 [387]

Answer:

A nuclear membrane is a double membrane that encloses the cell nucleus. It serves to separate the chromosomes from the rest of the cell. The nuclear membrane includes an array of small holes or pores that permit the passage of certain materials, such as nucleic acids and proteins, between the nucleus and cytoplasm.

6 0
2 years ago
Read 2 more answers
Are polymers always neutral?​
Nimfa-mama [501]

Answer:

The eight most common types of synthetic organic polymers, which are commonly found in households are:

Low-density polyethylene (LDPE)

High-density polyethylene (HDPE)

Polypropylene (PP)

Polyvinyl chloride (PVC)

Polystyrene (PS)

Nylon, nylon 6, nylon 6,6.

Teflon (Polytetrafluoroethylene)

Thermoplastic polyurethanes (TPU

8 0
3 years ago
Which of the following describes qualitative data a- Recording the temperature of a solid as it is warmed b- taking the mass of
Angelina_Jolie [31]

Answer:

C- Noting cloudiness occurs when two solutions are mixed.

Explanation:

This doesn't require using numbers; this requires using your senses to determine something, which is qualitative data.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is not an option for solving the world water crisis?
    8·1 answer
  • I need help on this page me no good at science
    15·1 answer
  • The elephant has 56 chromosomes in its body cells. when the elephant's body cells divide by mitosis, how many chromosomes will e
    5·1 answer
  • Suppose that a substance in a beaker is heated over a burner in a science lab. Which observation would most likely indicate that
    12·2 answers
  • What happens to the solids in wastewater at a wastewater treatment plant?
    8·2 answers
  • What kind of genetic variation in happy-face spiders was dr. gillespie studying?
    6·1 answer
  • What do phototropism and geotropism enable plants t do
    15·1 answer
  • New forms of drug-resistant bacteria can evolve quickly because
    8·1 answer
  • Natural gas grilling locations are determined by
    12·2 answers
  • What is the genotype ration between the cross YyRr x YyRr?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!