1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Functions in excrition
Roman55 [17]

Answer:The excretory system is the system of an organism's body that performs the function of excretion, the bodily process of discharging wastes. The Excretory system is responsible for the elimination of wastes produced by homeostasis.

Hope this helps :)

7 0
3 years ago
What is usually (but not always) related to the metabolic processes of living organisms in its organic form?
mafiozo [28]

Energy is usually related to the metabolic processes of living organisms in its organic form.

Many cellular processes require a steady supply of energy provided by the cell’s metabolism. Signaling molecules such as hormones and neurotransmitters must be synthesized and then transported between cells. Pathogenic bacteria and viruses are ingested and broken down by cells. Cells must also export waste and toxins to stay healthy, and many cells must swim or move surrounding materials via the beating motion of cellular appendages like cilia and flagella.

4 0
4 years ago
The cells in a cytoplasm of the _ are called _
densk [106]

Answer: The cells in a cytoplasm of the organellesare called cytosol.

Explanation:

8 0
3 years ago
5. The mangrove is a plant that lives in ocean water. What would happen if root cells from a mangrove
Tresset [83]

Answer:

it will wither since it has been placed on a fresh water.

Explanation:

since mangrove plant grows on a salty water environment the available water from the mangrove plant will move to a highly concentrated region to a lowly concentrated region

6 0
3 years ago
How does natural selection support the theory of evolution?
madam [21]
Only the strongest live on to pass on their genes. the weak die
5 0
3 years ago
Other questions:
  • With which archaic human species did some of the ancestors of modern europeans interbreed during the past 100,000 years
    8·1 answer
  • Respiration involves the release of energy due to the breakdown of large polymers. What type of a reaction is respiration?
    14·1 answer
  • What reaction occurs in the cristae of the mitochondria
    13·1 answer
  • Should my family keep a box turtle from the wild??
    8·2 answers
  • Explain how the energy investing and energy harvesting steps of glycolysis result in 2 ATP molecules.
    7·1 answer
  • When looking at the DNA of a elephant, a crocodile, and a sheep which two animals do you think would have more similar DNA and w
    7·1 answer
  • The tertiary structure of proteins arise due to ?
    8·1 answer
  • Which of these statements is correct about the role of the atmosphere in the two examples of Earth system interactions?
    13·1 answer
  • Individuals who inherit mutations in p53 would be expected to have what symptoms? see section 19.6 (page 393) .
    14·1 answer
  • CAN anyone pls answer dis!
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!