1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
A plant survives in a tropical rain forest. When placed in a temperate forest, it
svet-max [94.6K]

Answer:

A. The plant needs very stable weather.

Explanation:

A plant survives in a tropical rain forest. When placed in a temperate forest, it  dies within a year. The most likely characteristic of this plant is it needs very stable weather.

7 0
2 years ago
Read 2 more answers
If a man and a woman, each with sickle-cell trait, were planning to marry, what information could you provide them regarding the
kiruha [24]

Answer:

I'll inform them that the possibility of all their future children/offspring being phenotypically sickle-celled is very high.

Explanation:

Sickle cell is an inherited disease condition in which the red blood cells of the blood loses its shape and hence, dies or gets broken down. It has to do with the blood genotype of an individual. There are three major types of blood genotypes in humans namely: AA, AS, and SS. SS is the recessive genotype that codes for the sickle cell trait.

Hence, a human with the sickle cell trait has a genotype- SS. Therefore, according to this question, a man and a woman, each with sickle-cell trait (SS), were planning to marry, This will mean that both the man and the woman will always produce a gamete with S allele, which will combine to form an SS offspring. In other words, all of the offsprings of this man and woman will be sickle-celled.

7 0
2 years ago
How can you tell if an older rock is above a younger rock? explain.
kozerog [31]
The younger rock would be black and have like no stains and it would not be as dirty as the older rock hope this helps!!1
8 0
3 years ago
What causes the temperature change in the stratosphere?
Thepotemich [5.8K]

Answer:Its altitude

Explanation:

7 0
3 years ago
Read 2 more answers
What is a normal resting heart rate for adults, according to the american heart assocition
Reil [10]

Answer:

from 60 to 100 beats per minute

4 0
3 years ago
Other questions:
  • What is a hominid? I've looked everywhere and i cant find it.
    9·1 answer
  • When a plant performs photosynthesis the radiant energy of the Sun is..
    5·1 answer
  • Which of the following are considered macromolecules? Select all that apply. (2 points)
    12·1 answer
  • What structures are found within the nucleus?
    9·1 answer
  • The genus that includes the garden pea is PISUM and the species of a specific pea plant is SATIVUM. Choose the correct ways to w
    7·1 answer
  • What type of tree is the tallest tree in the world?
    5·1 answer
  • Consider three blood vessel segments of equivalent length and diameter: vessels A, B, and C. Pressure at the beginning of each s
    10·1 answer
  • In the first experiment, Dr. Palumbi applied heat stress to corals from different pools, warm and cool. Make a
    11·1 answer
  • Cellular respiration occurs in both plants and animals. why do plants need cellular respiration?
    13·1 answer
  • A chamber within a bone normally filled with air is a:
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!