1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Why can foods such as pineapples, pickles and tomatoes be treated with temperatures less than 100?
ratelena [41]
<span>The reason why foods such as pineapples, pickles and tomatoes can be treated with temperatures less than 100 is because t</span>hese foods are highly acidic (pH<4.6) which provides a hurdle to microorganims.
Low-acid foods have pH values higher than 4.6, while a<span>cid foods have a pH of 4.6 or lower. They include fruits, pickles, sauerkraut, jams, jellies, marmalades, and fruit butters.</span>
7 0
3 years ago
Assume that the point mutation and deletion mutation are not in overlapping regions of the phage genome. What phage recombinants
Vladimir [108]

Answer:

A recombinant phage containing both mutations.

Explanation:

A recombinant organism is produced by recombination, which is a genetic phenomenon associated with the repair of double-strand breaks in DNA. In genetic research, recombinant organisms are used to investigate target gene expression. The process of DNA repair may be associated with two different pathways: homologous recombination (HR) and non-homologous end-joining (NHEJ). In this case, the recombinant phage contains no overlapping mutations (i.e., both deletion and point mutations), thereby carrying the desired genetic combination.

7 0
3 years ago
What are agronomic characters of potato? How it is beneficial for the farmer?
Kruka [31]
Yara Crop Nutrition
Search

Search Yara
Toggle Menu

27
Print Page
Agronomic Principles
Crop Characteristics

Potatoes produce a fibrous root system. These roots are at best no more than 24in long. Thus potatoes are shallow rooted compared to cereals for example, which can root to at least 47in depth. As a result, potatoes are often unable to exploit nutrients and soil moisture at depth within a soil profile.

While root growth occurs when soil temperatures are between 50 to 95˚F (10 to 35˚C), best, most active root development is at soil temperatures of between 59 and 68˚F (15 and 20˚C).

Leaf (haulm) growth occurs at temperatures of between 44.6 to 86˚F (7 to 30˚C) , but optimal growth is at around 68 to 77˚F (20 to 25˚C). Optimum temperatures for stolon growth are similar.

effects of soil temperature on root development
The potato tuber is an enlarged portion of the stolon. The initiation of this tuber is triggered by short day lengths (photoperiods), and involves growth hormones. The colder the soil temperature, the more rapid the initiation of tubers and the greater the number of tubers formed. The optimum soil temperature for tuber initiation is 59 to 68˚F (15 to 20˚C).

Under these conditions, the potato plant will have short stolons and shoots. Longer day lengths delay tuber initiation and favor the growth of the stolon and shoot. High temperatures also reduce tuber formation. Late varieties seem to be more sensitive to long day lengths or high temperature conditions.

Low nitrogen and high sucrose levels in the plant favor the formation of more tubers.

Once formed, tubers grow rapidly, reaching a maximum rate of up to 1,249 lb/ac/day in temperate climates. See figure below:

potato tuber growth rate, germany
Physiological Aging

By planting sprouted seed, crop growth can be advanced. The magnitude of this response and its effect on increasing crop yield is related to the physiological age of the seed at planting.
6 0
3 years ago
Guess what percent of your DNA is the same as the following organisms.A weed? % the same as meA fruit fly? % the same as meA mou
kirill [66]

Answer:

The correct answer will be-

1. Weed- 40%

2. Fruit fly- 60 %

3. Mice- 97.5 %

4. Chimpanzee-98.5 %

Explanation:

Charles Darwin suggested that all organism on earth have descended from a common ancestor.  The modern technology-enabled humans to sequence the genome of an organism and compared them with each other.

When the human genome was compared with the genome of other organism found the similar sequences in them like - Weed shared 40% of the genome with humans, fruit fly shared 60% genome, mice showed 97.5% genome similarity and chimpanzees showed 98.5 % with the human genome.

On the basis of this, the chimpanzee was found to be the closest species to humans  

8 0
3 years ago
Read 2 more answers
True/False: Plant Viruses can only infect plant cells
Ratling [72]

Answer:

true

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Rock is classified into three main types by?
    10·2 answers
  • Where does the movement energy found in falling rain come from originally?
    11·1 answer
  • You are examining the DNA sequences that code for the enzyme phosphofructokinase in skinks and Komodo dragons. You notice that t
    15·1 answer
  • What makes man more than his body?
    14·2 answers
  • Which statement explains what happens to air temperature as elevation increases and why? As elevation increases, air pressure in
    6·2 answers
  • Enhancer I can stimulate the transcription of gene A, but the insulator blocks its effect on gene B Enhancer ll can stimulate th
    14·1 answer
  • The oceanic crust is composed mostly of which substance. why?
    8·2 answers
  • What is the primary consumer in the following food chain, sun - tomato plant - tomato worm - wasp?​
    15·2 answers
  • Which type of weathering most often occurs in windy environments?
    8·1 answer
  • Explain energy flow from producer to consumer.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!