1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Compare and contrast aerobic respiration with photosynthesis in
Nataliya [291]

Answer:

Aerobic respiration;this is the process of breaking down of glucose  <u>with Oxygen</u> to generate energy  as ATPs in living cells

Location- Matrix  and inner membranes of mitochondria

Energy source_oxidative phosphorylation of glucose

Waste product-water( oxygen accept the final electron to form water)

.

38 ATPs from 1 glucose molecule

Explanation:

Photosynthesis; this is the process of reducing C02 with hydrogen ion, from water  i<u>n the presence of  sunlight , enzymes and green pigment chlorophyll</u> to form <u>glucose</u>

Location- stroma and thylakoid membranes of chloroplast

Energy source-photo-phosphorylation(sunlight)

Waste product-Oxygen

18ATPs

5 0
3 years ago
In a hypotonic solution does water enter the cell, exit the cell, or
BabaBlast [244]

Answer: In hypotonic solution, most water exists the cell causing it to shrink

Explanation:

6 0
3 years ago
What gets passed from one cell to another in sexual reproduction
RoseWind [281]

Answer:

Cell division is the mechanism by which DNA is passed from one generation of cells to the next and ultimately, from parent organisms to their offspring. During meiosis, the cells needed for sexual reproduction divide to produce new cells called gametes.

8 0
3 years ago
Read 2 more answers
If a protein in your body was denatured (broken down, or changes shape) because of high temperatures or a change in ph, what eff
wel
The breakdown of tertiary and quartinary structures in a protein, a change in the active site
7 0
3 years ago
PLSSS HELP!!!!!
Ne4ueva [31]

Answer:

1- Mitosis (only)

2- Meiosis (only)

3- Meiosis (only)

4- Meiosis (only)

5- Both

6- Both

Correct me if I'm wrong

4 0
2 years ago
Other questions:
  • If water molecules inside and outside of a cell became non polar , how would the transport of materials in and out of the cell b
    10·1 answer
  • Genes are responsible for
    11·2 answers
  • Help ASAP Please Figure 5
    15·1 answer
  • Which of the following are found in the
    6·1 answer
  • Is a globe physical model. True or false
    15·1 answer
  • 1. Some worms eat at night (meaning they are nocturnal) and some worms eat during
    14·1 answer
  • A mother has a blood type a and her son has a blood type o. Which blood types are possible for the father?
    9·1 answer
  • A small piece of black paper was folded in half and use to cover part of the top and bottom portions of a leaf on the living ger
    5·1 answer
  • ________ cells are involved in fertilization.
    9·1 answer
  • The genetic code is defined degenerate or even redundant because:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!