1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Biological classification is important because it allows scientists to study organisms in a ___ way​
puteri [66]

Answer:

Systematic.

Explanation:

Biological classification is important because it allows scientists to study organisms in a systematic way​.

In Science, this biological classification of living organisms based on similarities or characteristics such as eyes, number of legs, etc., is generally referred to as taxonomy.

Taxonomy can be defined as the process of naming, classification and description of living organisms such as plants and animals. The eight (8) biological classification (taxonomy) used for grouping and organizing organisms are; kingdom, domain, phylum, family, order, class, species and genus.

Hence, taxonomy helps scientist to have a good understanding and knowledge when studying various organisms.

5 0
3 years ago
Predict the possible genotypes and phenotypes of the offspring produced from two
hammer [34]
If you were to draw a punnet square of two individuals with the genotypes Ss, there would be 1 box with ss, 2 boxes with Ss, and 1 box with SS.

The possible genotypes are SS, Ss, and ss.

The possible phenotypes are sufferers of sickle cell (ss) and non-sufferers (Ss and SS)
3 0
3 years ago
Dean plays various war games on his computer all the time, even when he has other things (e.g., work and studying) that need to
dmitriy555 [2]
There are four symptoms of addiction namely:

Obsession
Negative consequences
Lack of control
Denial

In this patient, he denies that his behavior is self-destructive; even with the concrete evidence that he is being self-destructive (i.e. plays all day even with work to do). There are two descriptions of denial wherein; (1) he denies that what he does cannot be controlled and (2) he denies that what he does leaves a negative impact in his life. This patient falls to the latter description of denial.
6 0
3 years ago
Read 2 more answers
Why do tumors create problems for organisms ?
harina [27]
Tumors are bunches of abnormal tissue growth, and they can constrict airways, and block your veins and arteries, causing them to be potentially fatal.
5 0
3 years ago
Read 2 more answers
What’s the answer to questions 17 and 19. Pls help me.
Damm [24]

Answer:

17: Mitochondria and Chloroplasts

19: The cell membrane is a double-layered sheet called a lipid bilayer. It affects the content of the cell because it controls what goes in and out of the cell.

4 0
3 years ago
Other questions:
  • Why do you think millions of sperm are needed to fertilize one egg?
    8·1 answer
  • If the strand of DNA was use what will be the complementary DNA produced
    7·1 answer
  • How do organelles function together in cellular processes?
    13·1 answer
  • Define photosynthesis. What organisms are capable of this process?
    15·2 answers
  • If sea floor spreading is happening why isn’t earth getting bigger
    7·1 answer
  • Anaerobic respiration produces a maximum of ______ ATP per glucose.
    11·1 answer
  • How many chromosomes are in a haploid cell?
    10·2 answers
  • Gas exchange in an echinoderm takes place through
    11·1 answer
  • Matter can change from one state to another if heated or cooled. If ice (a solid) is heated it changes to water (a liquid). This
    8·2 answers
  • Explain how asexual reproduction is different from sexual reproduction
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!