1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
The majority of bacteria have a cell envelope. which component of the cell envelope is found in only some bacterial cells?
lesya [120]

The majority of bacteria have a cell envelope component which serves as an outer compartment.

Explain the Plasma membrane components.

The membrane that divides the interior of the cell from the external environment is known as the plasma membrane, sometimes known as the cell membrane, and is present in all cells.

A cell wall is affixed to the plasma membrane on the exterior of bacterial and plant cells. A semipermeable lipid bilayer makes up the plasma membrane. The movement of materials into and out of the cell is controlled by the plasma membrane.

A cell is protected by its cell membrane, also known as the plasma membrane. Additionally, it offers a stable environment inside the cell. And that membrane serves a variety of purposes. One is to move compounds out of the cell that is harmful as well as nutrients into the cell.

Hence, the correct answer is the outer membrane.

Learn more about Plasma Membrane here,

brainly.com/question/14727404

# SPJ4

8 0
2 years ago
1 Pterodactyl (reptile)
goldfiish [28.3K]

Answer:

Analogous structures are structures which serve similar function in different organisms and evolved independently in two living organisms while homologous structures are the structures which are similar in related orgnanism due to inheritance.

The wings of Pterodactyl, bats and birds are conisdered as analogous structure. <u>they are similar in structure and same in function and evolved independently in the two groups of animals.</u>

Bones in  forelimbs of pterodactyl, bats and birds are  considered homologous  structures as <u>they inherited the pattern from a common ancestor and have different functions.</u>

5 0
3 years ago
Scientists originally thought cell membranes evolved before RNA. However, recent evidence suggests RNA developed before the memb
Darya [45]

Answer:

The need for replication, specialization, compartmentalization is key to understand that RNA evolved first

Explanation:

Logical contrast considering a certain catalytic activities of cardinal importance in the early evolution of life ;

• using an RNA molecule that is involved in to catalyzing the process of templated polymerization –selecting a random RNA molecule as a template.

• the ribozyme activity in this process must have engaged an in vitro process in a body part that no longer has a function such that it that can only synthesize moderate lengths of RNA

• when this molecules acts on the copies of itself can replicate

• when it acts on copies of other type of RNA molecules in its surrounding he can promote their replication

• a cooperative system might have evolved from the neighbors to help the survival of this friendly RNA molecules – through catalytic actions, such that a set of different types of RNA molecules evolves with a mark of specialization for different activity.

The development of individual compartments is proposed to be akin to the effective self-replicating systems.

• If RNA molecules are mutually beneficial they may serve the purposes of being specialized for templated polymerization.

• If these RNAs were free to diffuse among a large population of other RNA molecules, they could be assimilated into an established group by other replicating systems, which in turn may compete with the original RNA system for raw materials.

• The quality of the self-replicating systems they generated relies on the compartment that restricts the RNA molecules only to the system they serve.

• compartments started simply and perhaps had simple adsorption on surfaces or simple particles.

• compartmentalization became complex requiring a class of small molecules with varying physicochemical properties liike being amphipathic.

• This gave rise to the phospholipids mainly and the present-day cells often are coated by a plasma membrane consisting of amphipathic molecules in this configuration.

3 0
3 years ago
Although meat lacks cellwalls, repeated freezing and thawing
IgorC [24]

Answer:

Lysosome

Explanation:

Freezer burn occurs due to the sublimation of ice in unprotected meat rich in muscles during long-frozen storage. It appears after thawing. The ice crystals rupture the lysosomes which in turn contain hydrolyzing enzymes.

Leakage of the hydrolytic lysosomal enzyme causes freezer burn and affects the appearance of the frozen meat. The hydrolytic enzymes of lysosomes partially digest the cells which in turn impart bad flavor to the stored food.

8 0
3 years ago
Placer deposits form when _____.
Mice21 [21]

Answer: heavy eroded particles settle out of moving water

Placer deposits forms when rocks weathered due to the effect of water. The heavy minerals from the rocks get settled down in water. Minerals that form placer deposits  have high specific gravity, they are resistant to chemical weathering process and are durable.

8 0
3 years ago
Read 2 more answers
Other questions:
  • A smooth, egg-shaped hill left behind by a glacier is called a(n)
    8·1 answer
  • What is found in the nucleus of an atom? Question 1 options: electrons neutrons and protons protons and electrons neutrons and e
    13·2 answers
  • Which characteristic is shared by all mollusks and echinoderms?
    8·2 answers
  • What is the crescent shaped surface of liquid that forms in pipettes and graduated cylinders?
    6·1 answer
  • Help! in which layer of the sun is energy transferred between atoms?
    10·2 answers
  • How do people tend to use land as the human population increases?<br> Human and environment
    10·1 answer
  • 20. A solution of pH 2.8 is?<br> A. acidic<br> B. basic<br> N. neutral
    13·1 answer
  • WILL GIVE BRAINLIEST
    10·1 answer
  • PLEASE HELPPP!!!!!!ASAP!!!!!!!!!!! PLEASEE!!FIRST ANSWE WILL BE MARKED BRAINLIST!!!
    14·2 answers
  • Which of the following muscles adducts the arm?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!