1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Aquatic organisms are able to survive when the temperature decreases. These organisms survive even when the surfaces of lakes an
umka2103 [35]

Answer:

Anomalous expansion

Explanation:

Anomalous expansion of water is the abnormal way water expands when exposed to low temperature.

At 4 degree Celsius , the density at the top layer is usually at the Maximum which makes the water sinks down and then the water in the lower layer rises up.

When the temperature drops below 4 degree Celsius, the water molecules at the top then freezes leaving the denser molecules at the bottom which doesn’t freeze as a result of their high density.

This way, organisms can survive in the water due to the lower layer not freezing.

5 0
3 years ago
Which are vectors?<br><br><br> animals<br> water<br> air<br> food<br> objects
Rainbow [258]
Objects are vectors
3 0
2 years ago
Read 2 more answers
Looking at the image of the freshwater lake ecosystem in the reading, can you name biotic and abiotic factors in this specific e
just olya [345]

Answer:

Unfortunately, there is no image here. Perhaps you could provide us with it?

Explanation:

4 0
3 years ago
Explain how the biosphere facilities movement of water from the geosphere to the atomosphere.
omeli [17]

Answer:

Explain how the biosphere facilitates movement of water from the geosphere to the atmosphere. The biosphere includes all living components of the Earth. ... Water from the plants is incorporated into the atmosphere through a process called transpiration, where water from the plant evaporates and enters the atmosphere.

6 0
3 years ago
Which types of mutation are possible thanks to the redundant nature of the genetic code?
krok68 [10]

Cancer is a type of harmful mutation.

3 0
3 years ago
Other questions:
  • Twin studies have confirmed that genetic and environmental factors operate __________ to guide development.
    10·1 answer
  • Which is the most important approach for the nurse to use when applying a nasal cannula?
    7·1 answer
  • In normal chicken cells which phase requires the longest time for completion
    7·2 answers
  • Some viruses can be crystallized and their structures analyzed. one such virus is yellow mottle virus, which infects beans. this
    8·1 answer
  • Two homozygous blue flowers are crossed.<br> How would you solve it?
    9·1 answer
  • Mammals have two traits that set them apart from all other animal.
    11·1 answer
  • Water that is heated by the sun turns into water vapor. Look at the hydrologic cycle diagram.
    12·2 answers
  • How are sperm cells adapted for their functions​
    9·1 answer
  • Which letter on the graph shows exponential growth.
    9·1 answer
  • In muscle cells, fermentation produces _____. In muscle cells, fermentation produces _____. carbon dioxide, ethanol, and NAD car
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!