1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
4 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]4 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
What planets have living things on it
Blababa [14]
Earth there is no aliens
3 0
3 years ago
Read 2 more answers
Which of the following is an example of an out dated theory based on the consensus of the scientific community
meriva
C) heliocentric theory  is what I think is the correct answer

4 0
3 years ago
Read 2 more answers
_____ is an area in the left frontal lobe of the brain that is involved in speech production
bogdanovich [222]
<span>BROCA'S AREA Broca's area or the Broca area is a region in the left frontal lobe of the dominant hemisphere of the hominid brain with functions linked to speech production. Broca area, also called convolution of Broca, region of the brain that contains neurons involved in speech function. This was discovered in 1861 by French surgeon Paul Broca, who found that it serves a vital role in the generation of articulate speech.</span>
5 0
4 years ago
You are a chicken breeder interested in developing new hybrids that have many of the genes from the original ancestor birds. wha
Lostsunrise [7]
<span>If you are a chicken breeder who is interested in developing new hybrids that have many of the genes from the original ancestor birds, you should breed your birds with other birds that have similar genes to the original ancestor birds. In this way, you can combine the ancestor birds genes with those of your own birds to create a new hybrid.</span>
5 0
4 years ago
Action potential in a motor neuron triggers the release of what neurotransmitter?
vodomira [7]

Answer:

Action potential in a motor neuron triggers the release of acetylcholine (ACh) neurotransmitter.

Explanation:

Acetylcholine: It is a neurotransmitter released by motor neurons which bind to the receptors end plates of the motor. When an action potential travel down the motor neuron's axon, neurotransmitter release occurs resulting in an influx of calcium and altered permeability of the synaptic terminal membrane.

The Ca2+ ions allow synaptic vesicles to move and bind with the presynaptic membrane which is present on the neuron and released neurotransmitter from the vesicles into the synaptic cleft. Once it's released ACh diffusion occurs across the synaptic cleft to the motor end plate, and binds with ACh receptor. As the neurotransmitter ACh binds, these ions channel open and sodium ions cross the membrane into the muscle cells.

In this phase reduction of voltage inside and outside the cell occurs, which is known as depolarization. When ACh binds to the motor end plate this depolarization is known as end plate potential. Then depolarization spread with the sarcolemma and creating an action potential. This action potential moves the entire cell and creating a wave of depolarization.

5 0
3 years ago
Other questions:
  • Which term is correct for one female arctic fox?
    6·2 answers
  • If a gene contains 300 dna nucleotides, how many amino acids will the protein that is assembled from this gene contain?
    10·1 answer
  • The species richness of a community refers to the A) number of food chains. B) number of different species. C) energy content of
    10·1 answer
  • Order of EMBIOPTERA​
    12·1 answer
  • As DNA is replicated, which DNA base pair will bond to cytosine?
    9·2 answers
  • What is an underwater volcano called
    13·2 answers
  • If the starting population of the prey is higher than the predators, the carrying capacity of the seals will be _________ than t
    14·2 answers
  • Various species of birds have evolved characteristics that help them survive in their own
    9·2 answers
  • The location of the ventricles of the brain are associated with specific brain structures learned in this lab. For this question
    15·1 answer
  • A solution with a pH of 7
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!