1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Explain the role of enzymes as biological catalysts that lower the activation energy of a reaction.
tia_tia [17]

Answer:

Enzymes are one kind of protein which functioning as catalyst  that speed up reactions by lowering activation energy.Enzyme accelerate a reaction without altering its chemical equilibrium.

Explanation:

Energy which is required for  start a biochemical reaction is called activation energy.Activation Energy helps to jump and start a thermodynamically favorable reactions.

Enzymes can  many  way to its activation energy.

1. The enzyme may hold the substrates in such a way as to distort the substrate bonds closer to their form in the transition state. This reduces the amount of energy needed to complete the transition.

2.Enzyme create a charge distributor which opposite of transition state his lowers the energy of the transition state and decreases the activation energy.

3.The enzyme may reduce the reaction entropy   by bringing substrates together in the correct orientation to react.

4. The enzyme may provide a completely different chemical pathway for the reaction. It may form new bonds in the ES complex that would be difficult to form without the enzyme.

6 0
4 years ago
The properties of a compound are different
notka56 [123]

Answer:

fals I think sorry if it's wrong

6 0
3 years ago
When the cell duplicates chromosomes and separates into two separate nuclei, the cell is said to be in what phase?
Leviafan [203]
S PHASE

<span>Cell division involves the different phases such as G1, G2, M and S phase. Cell division is the mechanism of cells to divide into other cells. Two types of cell division is popularly called the mitosis and meiosis. There basic difference is how they function and how many chromosomes their daughter cells have. </span>
7 0
3 years ago
Read 2 more answers
Angiotensin II is a potent ____________ that helps regulate blood pressure. Angiotensinogen, is an inactive hormone synthesized
Hatshy [7]

Answer:

Angiotensin II is a potein VASOCONSTRICTOR that helps regulate blood pressure. Angiotensinogen, is an inactive hormone synthesized and released continuously from the LIVER. Its activation, which occurs within the BLOOD, is initiated by the enzyme renin. Renin is released from the juxtaglomerular apparatus of the KIDNEYS in response to either (1) LOW blood pressure (as detected by decreased stretch of BARORECEPTORS within granular cells, or by decreased NaCl detected by CHEMORECEPTORS within macula densa cells); or (2) stimulation by the SYMPATHETIC  division. The sequential action of renin and angiotensin converting enzyme (ACE) causes the formation of angiotensin II (the active form of the hormone).

Explanation:

Angiotensin is a peptide hormones that regulate blood pressure by causing increase in blood pressure through vasoconstriction. It is a part of the renin- angiotensin system that regulate the internal pressure of the blood. It is stimulated when the level of blood pressure reduces or there is an decrease in the sodium chloride in the blood. It effects is to vasoconstrict the blood vessels thereby increasing the blood pressure in the vessels. Angiotensinogen is the inactive hormone synthesized by the liver and upon activation through baroreceptors or chemoreceptors, the liver releases angiotensinogen into the blood stream to be ctivated by the enzyme secreted from the kidney's juxtaglumerular apparatusand then activated to teh angiotensinogen I, angiotensinoI is then activated into angiotensin II by the angiotensin II by the angiotensin converting enzyme. Angiotensin also causes the increase in the aldosterone secretion from the adrenal cortex to promote the retention of sodium by the kidneys, this also helps to increaee the blood pressure. Various receptors helps in signalling the body to a reduced blood pressure level. This includes the baroreceptors which are pressure receptors and detect changes in pressure of the blood; chemorecptors which are chemical receptors that detect the change in the concentration of sodium and chloride ion in the blood. All this function together with the sympathetic division of the CNS to help the body regulates its change in blood pressure in a given time.

3 0
3 years ago
Familiar Faces Describe a trait that both dogs and cats have which would set them apart from these other species.
ZanzabumX [31]
Isn’t that good but i will you get a new one and a new one for the team next week and will be back to work
8 0
2 years ago
Other questions:
  • Why are mammals more closely related to birds than to amphibians?
    6·1 answer
  • What kind of sequence or structure would you classify this as
    5·1 answer
  • (multiple choice) Daytime temperatures on Mercury are extremely hot because:
    12·2 answers
  • A client resides in a long-term care facility. which nursing intervention would promote increased dietary intake?
    7·1 answer
  • Which polypeptide chain will be made during translation of the following DNA sequence? -G-C-T-T-A-G-T-C-C-A-T-A
    10·2 answers
  • What are environmental factors that affect the rate of photosynthesis
    7·1 answer
  • In one hospital, pseudomonas aeruginosa serotype 10 infected the biliary tract of 10 percent of 1300 patients who underwent gast
    7·1 answer
  • Which trait is Lisa most likely to inherit from her mother? pierced ears pink hair bright red lips brown eyes
    9·2 answers
  • What does the term "plastic" mean when saying that "the mantle is plastic"?
    7·2 answers
  • Which phrase describes a nuclear chain reaction?(1 point)
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!