1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Give an example of a chemical adaptation. State the name of the organism and describe the adaptation. Discuss how this adaptatio
lesya [120]

Answer:

Answer is explained below;

Explanation:

Adaptation is referred to as a change or mutation that occurs in an organism that helps it to survive in its environment. The three types of adaptations include structural or morphological, physiological or chemical and behavioral adaptations.

  • Physiological or chemical adaptations.

Physiological or chemical adaptations are adaptations that do not show from the outside and are based on the body chemistry and metabolism of organisms which enable them to regulate their body functions and perform certain peculiar functions such as defense mechanisms in order to survive in its environment. Examples include the toxins released by certain plant leaves to repel herbivores, compounds present in the saliva of the mosquito to prevent blood coagulation, the more efficient kidneys of desert animals, etc.

For example, in certain marine organisms that are sedentary or move slowly such as starfish or sea stars, the chemical adaptation helps them to protect from predators. They excrete some chemicals from their skin as a defense mechanism that is harmful to the predators.  

Whales are marine mammals that migrate to large distances and spend most of their time in arctic, tropical or temperate waters. In order to survive these temperature changes, they maintain a constant body temperature that is not dependent on the surrounding water. So, they are called endothermic or warm-blooded animals.

  • Structural (morphological) adaptations.

A change that occurs in the appearance or morphology (structure) of an organism in order to survive in its environment is known as structural adaptations. Examples of structural adaptations include the sharp eyesight of predatory birds,  small ears of Arctic foxes to retain body heat, corky bark of trees to protect from wildfires, etc.

  • Behavioral adaptations

Behavioral adaptations are adaptations that affect the behavior or action of an organism in order to survive in its environment. Examples include birds migrating to warmer winter climates, hibernation of bears to escape the cold, desert animals active at night during hot summer weather, etc.

3 0
4 years ago
Ways to study the past climates of earth
suter [353]

Answer:

look it up or go to the  library for books

Explanation:

5 0
4 years ago
What is a key element found in all carbohydrates liquid proteins and nucleic acid please give me the answer
Delvig [45]
I’m pretty sure the answer is carbon
3 0
4 years ago
Read 2 more answers
Which two stages differ the most between meiosis l and ll?
navik [9.2K]

Answer:

I know... I know

Explanation:

Prophase and anaphase (Prophase 1 includes steps that are absent in prophase II, and anaphase 1 involves the separation of homologous chromosomes while anaphase II involves the separation of sister chromatids.

Enjoy!

8 0
3 years ago
A scientist is comparing the outer layer of an onion celk to the outer layer of a human skin cell. What is unique about the oute
lord [1]

It contains cellulose.

5 0
3 years ago
Other questions:
  • Epstein (1965) presented observers photographs of a quarter, dime, and half-dollar that were all equal in physical size. his res
    14·1 answer
  • As thermal energy is added to a substance, which of the following changes can be predicted?
    6·1 answer
  • What particles make up the atom? Give their charge and location
    12·1 answer
  • Chemical substances secreted by cells into the extracellular fluids and that regulate the metabolic function of other cells in t
    12·1 answer
  • Compared with a eukaryotic cell, a prokaryotic cell Select one:______
    10·1 answer
  • Make a list of ecological consequences that you can infer have occurred on Guam due to the introduction of the invasive (nonnati
    5·1 answer
  • 6. Which of the following is a nonmetal?<br> a. Fe<br> b. AI<br> C. N<br> d. Si
    11·2 answers
  • Which of the following were not part of the Harvey Company?
    9·1 answer
  • Yeast and Morels comparison
    14·1 answer
  • A scientist hypothesized that when two pea plants, both having the genotype all of the offspring would have at least one dominan
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!