1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
3 years ago
13

Please help me with this

Biology
1 answer:
Rasek [7]3 years ago
5 0

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

You might be interested in
Which position shows the Moon at Last Quarter?<br><br> A<br><br> E<br><br> C<br><br> F
Stells [14]

Answer:

a shows the moons position at the last quarter

3 0
3 years ago
A patient will be taking amiodarone [cordarone]. which baseline tests are necessary before this medication is started? (select a
olga55 [171]
Upon researching, I believe the choices are:

<span>A. Chest radiograph and pulmonary function tests
B. Complete blood count with differential
C. Ophthalmologic examination
D. Renal function tests
E. Thyroid function tests
</span>
Among these, the baseline tests necessary for the patient before taking the medication are: A. Chest radiograph and pulmonary function tests, C. Ophthalmologic examination, and E. Thyroid function tests. This is because Amiodarone has several possible toxic side effects. Some of these are thyroid toxicity, opthalmic effects, and pulmonary toxicity. Thus, it is necessary to first know the baseline of the patient for these systems and then checking if the results have deviated much after he/she takes the medication.  
5 0
3 years ago
Read 2 more answers
In a pig 1 hour after eating corn the primary source of blood glucose will be
Step2247 [10]
The correct answer should be, <span>Absorbed glucose.</span>
7 0
3 years ago
In an asexually reproducing organism it is expected that the offspring will be genetically identical to the parent. However, in
JulsSmile [24]

Answer:

Mutation

Explanation:

I believe it is a mutation. A mutation is when the DNA is copied with a small mistake. Ex: AGCC => AGGC

Then, after a mutation, the DNA isn’t exactly identical because of this mistake in the DNA after copied.

I hope this helped! Happy Thanksgiving! GOBBLE GOBBLE!

3 0
2 years ago
A pathogenic strain of bacteria has become resistant to an antibiotic that once could kill it. What has happened to these bacter
Andrews [41]
The answer is <span>-Only the few bacteria that were immune to the antibiotic survived and reproduced, making all their offspring immune to it as well.

Bacteria (or any other organism) are not able to make changes to their DNA in order to protect themselves or to learn to remove the receptors on their cell surfaces. If they were able to produce toxins against the antibiotics, they would all survive.
These leave the second choice as the correct answer. This is the real situation, and is a good example of natural selection.</span>
6 0
3 years ago
Other questions:
  • A hurricane hits a small island, killing all but a few members of a bird population. this is an example of __________.
    12·1 answer
  • Do brain cells live longer than all of the cells in your body
    15·1 answer
  • Humans do this only every 10 months. Other organisms such as insects, can do this every 2 weeks. Is this reproduction or evoluti
    14·1 answer
  • In addition to phospholipids, which of the following organic molecules are also a part of cellular membranes?
    9·1 answer
  • What is the magnification power of the ocular lens
    15·1 answer
  • Self-modification is the self-implemented behavior program that helps people change their behavior. T/F
    14·2 answers
  • Ruth is quite attractive (a 4 on a 5-point scale), but Naomi is strikingly attractive (a 5 on a 5-point scale). Research suggest
    15·1 answer
  • Use the graph to answer question 1.
    11·1 answer
  • When comparing the virus/bacteriophage to the host cell that it infects, which statements are accurate? Select all that apply
    10·1 answer
  • Q1. Which of the following events occurs during systole?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!