1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
3 years ago
7

2. Use the mRNA sequence to find the DNA and complementary sequence and the

Biology
1 answer:
steposvetlana [31]3 years ago
6 0
3- TACGGATGTACACCACATTGGAA -5
You might be interested in
"All other things being equal, suppose Neurons A and C release glutamate to a target neuron, and Neuron B releases GABA to the s
Eva8 [605]

Answer:

When neurotransmitter molecules bind to receptors located on a neuron's dendrites, ion channels open. At excitatory synapses, this opening allows positive ions to enter the neuron and results in depolarization of the membrane—a decrease in the difference in voltage between the inside and outside of the neuron

Explanation:

5 0
3 years ago
What element do nucleotides possess but proteins do not​
DENIUS [597]
Ok that is the in that picture

8 0
4 years ago
Here you guy's go now can you help me please
ser-zykov [4K]

Answer:

Whats the question?

Explanation:

4 0
3 years ago
Which is most responsible for the decay of dead organisms?
motikmotik

insects and buzzards/vultures.

7 0
4 years ago
Read 2 more answers
Item 5 What is the role of a generator in producing electricity? The generator stores electrical energy for later use in homes a
Anni [7]

Answer:

The generator transforms the mechanical energy of the turbine into electrical energy

Explanation:

Electricity generator is a device that is used in generating power supply which can be used in industries, homes and for commercial and private purposes.

It operates by converting mechanical energy into electrical energy for the use in an external circuit. mechanical energy can be obtained from steam turbines, internal combusting energy, gas and water turbines and it can be obtained through the rotating shaft.

The capacity of each generator determines the amount of energy it can supply to a given place.

4 0
4 years ago
Other questions:
  • A primary healthcare provider calls the intensive care unit and orders 10 mg of morphine every 4 hours for a patient's pain. wha
    15·1 answer
  • How will the movement of water affect a cell if it is transferred from a hypotonic solution to a hypertonic
    12·1 answer
  • Which of the following is true for a cell that has a nucleus
    8·1 answer
  • An adaption is a change that occurs over time naturally within a population due to environmental influences. Which of the follow
    9·1 answer
  • Where is caulerpa native
    5·1 answer
  • What are the features of each of the three compositional layers of Earth?
    6·2 answers
  • Why is radiation an effective treatment<br> for cancer?
    15·1 answer
  • Point mutations resulting in a single amino acid substitution provided evidence that: Select one: A. The genetic code is a tripl
    8·1 answer
  • Which type of cell division is responsible for the sequoia tree growing bigger?
    12·2 answers
  • (GT.03] The theory of Natural Selection was accepted after it got consensus from
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!