The Krebs cycle is also known as the Calvin cycle Pyruvic acid cycle Carbon - oxygen cycle Citric acid cycle

Biology

1 answer:

yawa3891 [41]3 years ago

3 0

The answer of the question is citric acid cycle

You might be interested in

Which component of a virus is lacking in a cell

luda_lava [24]

<span>The question says, 'which component of a virus is lacking in a cell. The answer is capsid. virus capsid are protein shell of a virus, they envelope the virus and protect it from harm. Cells does not have capsid, they have rigid cell wall instead. The rigid cell wall protect the cell from harm and also give the cell shape.</span>

8 0

3 years ago

A cylinder at left with balls evenly spaced throughout the cylinder has an arrow leading to a cylinder at right cylinder with ba

nata0808 [166]

Answer:

C. Atoms lose energy as a gas changes to a solid.

Explanation:

Physical changes of matter take place by adding or removing energy from the matter.

In the given images, The<em> left cylindrical is showing gas phase while the right cylindrical is showing a solid phase.</em>

The process of conversion of gas into solid is called deposition. Deposition process takes place when atoms lose their energy and have high kinetic energy so they directly convert into solid and not into liquid.

Hence, the correct option is "C".

3 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

___ prey on animals

Aleonysh [2.5K]

Carnivores. Herbivores, on the other hand, prey on plants.

3 0

3 years ago

Read 2 more answers

Please help ASAP!

igomit [66]

Meiosis I creates 2 diploid cells and meiosis II creates 4 haploid cells.

8 0

3 years ago