1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liono4ka [1.6K]
3 years ago
8

If a small drop of tiny particles such as pollen grains are dropped into a drop of water on a microscope slide, they will appear

to vibrate and spread out. The primary reason for this is
Biology
1 answer:
Rufina [12.5K]3 years ago
7 0

Answer:

The primary reason is that the pollen grains are being struck by water molecules that move in different directions. These strikes fluctuate and sometimes are uneven.

Explanation:

This vibration and spread out of molecules in water is called Brownian Motion. It is the result of the collision of small particles of water with big particles of pollen. As the particles of water move randomly hitting different sides of the pollen particle, at times, there will not be a coordinated movement, but as the movement of water particles is random, there will be moments when one side of the pollen particle will collide with more water particles, when this happens there is an unbalanced force that makes the pollen particle moves in a direction.

You might be interested in
Omar studies the effects of a drought on the water level in a pond. He takes a reading of the water depth at the same location i
Goryan [66]
A ..................................................
8 0
3 years ago
Read 2 more answers
Sweat is the result of which life function?
telo118 [61]
<span>Human sweat is a result of our body getting over heated. We sweat through our pores so our temperatures don't go up and as a result we stay at a normal temperature. We may feel hot but that's because we are hot from the heat of something. If we didn't sweat then our temperature would become very high and we would die.</span>
6 0
3 years ago
Read 2 more answers
Which of the following statements about NAD+ is true?
irga5000 [103]

Answer:

NAD+ is reduced to NADH during glycolysis, pyruvate oxidation, and the citric acid cycle.

Explanation:

8 0
3 years ago
What are the 10 central themes of biology and can you explain them?
nlexa [21]

Answer:

1. Emergent Properties

2. The Cell

3. Heritable Information

4. Structure and Function

5. Environmental Interactions

6. Feedback and Regulation

7. Unity and Diversity

8. Evolution

9. Inquiry

10. Science, Technology, and Society

Explanation:

1. The fact that complex organisms derive from small, simple bases.

2. Basic unit of life

3. Found in dna of all living organisms, passed from generation to generation.

4. All parts of organisms serve a purpose. (heart pumps blood)

5. All organisms are involved with their surroundings (plants use sunlight for energy

6. Bodies give us feedback on whether or not things are safe for habitation. (its too hot or cold)

7. All organisms may differ in looks but we are made up of similar DNA

8. explains how organisms develop over decades

9. scientists search for new information

10. We learn about the world through biology.

8 0
3 years ago
What kind of nucleic acid is found in retroviruses? ​
yKpoI14uk [10]

Answer:

A retrovirus is an RNA virus that is duplicated in a host cell using the reverse transcriptase enzyme to produce DNA from its RNA genome. The DNA is then incorporated into the host's genome by an integrase enzyme. The virus thereafter replicates as part of the host cell's DNA.

7 0
3 years ago
Other questions:
  • Plants that reproduce sexually and have flowers are called_____.
    11·2 answers
  • Two similarities between the way<br> that a fungus feeds, and the way that<br> you feed.
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is the correct term for anthropology’s commitment to studying the entire picture of human life, including culture, biology,
    7·1 answer
  • Most streams result from _____. <br> a. altitude <br> b. melted snow <br> c. oceans <br> d. rivers
    8·2 answers
  • Islands like St. George Island and Dog Island are common along all coastlines in Florida (Merritt Island is another example). Id
    8·1 answer
  • What stage ensures that each cell receives an identical set of DNA during mitosis?
    12·1 answer
  • If there are 8 chromosomes in the parent cell, after Mitosis , how many chromosomes will be in the 2 daughter cells created?
    9·1 answer
  • Green plants appear green to human eyes because
    6·2 answers
  • Which describes a pathway that tends to slow down a process?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!