1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Akimi4 [234]
3 years ago
9

Charles darwin was influenced by three scientists of his time: charles lyell, jean-baptiste de lamarck, and georges cuvier. what

common theme from their work inspired darwin's theory of evolution through natural selection?
Biology
1 answer:
gogolik [260]3 years ago
6 0

can i get a gg in the chat for that guy

You might be interested in
________ is a condition in which there are bulges in the walls of the colon.
Julli [10]
Diverticular disease is the condition
8 0
3 years ago
How could fish-eating birds land on rocky islands be important in the formation of a new community of living things?
maks197457 [2]

Answer:

they would provide nutrients for new living things to feed on.

Explanation:

Fish eating birds would need important in the formation of a new community of living things because as they feed on these fishes on the rocks, they would also be eliminating wastes. The wastes that are being eliminated would serve as a source of nutrient on the Island. With time there would be enough nutrients for plants to tart growing

7 0
2 years ago
What do CAM plants do to help reduce the loss of water and still capture carbon dioxide ?
sweet-ann [11.9K]
The answer is the letter D
8 0
3 years ago
Stage of development for animals​
garik1379 [7]

Answer:

the beginning growth stage

6 0
2 years ago
Read 2 more answers
Somalia is located on the coast of Africa, east of Ethiopia.<br><br> True<br> False
USPshnik [31]
Yes, It's true Somalia is at the very east of Athupia
7 0
3 years ago
Other questions:
  • What type of asexual reproduction where offspring grows out of the body of the parent?
    11·1 answer
  • If you weigh 38 kilograms on your bathroom scale, your weight in space will be
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Does every organism have the same number of chromosomes?
    13·2 answers
  • What is the difference between a community and a population?
    12·2 answers
  • The process of cellular respiration begins with molecules of _______ and ends with the production of _______.
    15·2 answers
  • PLEASE ASAP! GIVING BRAINLIEST!
    14·2 answers
  • Simplify 15/125 to it lowest form​
    9·2 answers
  • Question 4
    14·1 answer
  • What is a bottle terrarium ??<br><br>Help;). <br><br><br>Give 4 to 5 sentence ​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!