1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastaziya [24]
3 years ago
12

Why do we need to wash our hands before eating and after using washrooms?

Biology
1 answer:
Dmitry_Shevchenko [17]3 years ago
8 0
Because bacteria could get on our hands through out eyes, ears, mouth, or nose (since all of which is noted to be connected to one another) and it could make you extremely sick. Although some bacteria is good for you, an extreme amount can make you extremely sick.
For example, you can contract ecoli and if that's not treated it can be fatal because you lose a ton of fluid and nutrients! Good luck, rockstar. I hope this is what you were looking for, and you pass! (:
You might be interested in
What 2 components are often found as part of an enzyme
katen-ka-za [31]
That would be peptide bonds
4 0
3 years ago
The axon: carries information toward other neurons. forms connections with other neurons. receives signals sent from other neuro
Alik [6]

Answer:

Explanation

The Axon or nerve fibre is a long, thin projection of the neuron or nerve cells that sends signals in the form of electrical impulses from the cell body (soma) to the synaptic terminals. The axons are of two types: myelinated and unmyelinated. The unmyelinated axons lack myelin sheaths which make the transmission of electrical impulses slower while the myelinated axons transmit electrical impulses faster.

8 0
3 years ago
Read 2 more answers
What can you conclude about the advantage of the cell membrane being made up of phospholipids?
sergiy2304 [10]
The phospholipid bilayer is a universal component of all cell membranes. Each phospholipid molecule has a hydrophobic(water repelling) and a hydrophilic( attracted to water) end. This allows the phospholipids to arrange themselves in a way that makes a cell membrane not able to dissolve in water. The bilayer is also semi-permeable which allows only certain molecules to enter the cell.
 
hope this helps
4 0
3 years ago
Removing vegetation from a slope ___ the erosion of topsoil.
balandron [24]

Answer:

Increases (dont mind this it's to get past the letter minimum)

Explanation:

Your answer is increases

3 0
3 years ago
Please help whoever’s right I’ll give brainliest
Ann [662]

Answer:

organism

system

tissue

organ

cell

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • In 1665 what structures did Robert Hooke observe through a microscope?
    6·1 answer
  • Cross sections of different areas of the same plant show cells with very
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Self-modification is the self-implemented behavior program that helps people change their behavior. T/F
    14·2 answers
  • Please do 2,3, and 4
    8·1 answer
  • Explain the need for ventilation systems in a multicellular organism
    13·1 answer
  • Help fill this chart out !!!
    11·1 answer
  • True / Fasle
    7·1 answer
  • In the Northern Hemisphere, climate scientists observe seasonal changes in carbon dioxide concentration with the highest levels
    15·1 answer
  • The backbone of DNA and RNA is composed of
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!