1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
3 years ago
10

I still dont get the stages of Mitosis. Please give me a descripition for each one

Biology
2 answers:
Inessa05 [86]3 years ago
8 0
Prophase- <span>chromosomes become visible as paired chromatids and the nuclear envelope disappears.

metaphase- </span><span>chromosomes become attached to the spindle fibers.

anaphase- </span><span>chromosomes move away from one another to opposite poles of the spindle.

telophase- </span><span>the final phase of cell division in which  chromatids, or chromosomes, move to opposite ends of the cell and two nuclei are formed.</span>
Tems11 [23]3 years ago
6 0
Prophase:chromatin are packaged to chromosomes
metaphase:chromosomes are lined up in lines that the centremore is in the half of the line
anaphase:the chromosomes are held from the opposite sides now we have 1 chromatid on a line but vertically we have a full set of chromosomes
telopphase:a nuclear membrane is formed around the chromosomes
You might be interested in
Why are fungi fossils so rare?
Volgvan
The reason as to why fungi fossils seem so rare is that they are usually microscopic and often difficult or impossible to identify. Not much information on fungi fossils has been documented. This could be because fungi fruiting bodies consist of soft, fleshy and easily degradable tissues which due to their poor integrity do not keep or preserve as well as animal tissue. Even when available, it takes a trained eye to recognize fungal fossils. Not many people have the training and expertise to recognize the fossils.
7 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What is indicated by two species having similar amino acids in the hemoglobin protein?
Anna71 [15]
Answer: The two species were Rhesus monkey and Human <span>
Hemoglobin protein is the iron containing protein found in the red blood cells which function by transporting oxygen through the blood stream from from the lungs to the tissues and it is important for survival. However, the  two species that have similar amino acids in the hemoglobin protein were Rhesus monkey and Human because they were not far from others.</span>
3 0
4 years ago
Why are mushrooms important to the food chain?
Arisa [49]
<span>It breaks down and decomposes dead animal and plants.</span>
3 0
3 years ago
Read 2 more answers
In a research study, the term “population” refers to:
TiliK225 [7]

Answer:

D

Explanation:

Population is generalized to all individuals.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Molluscs share a three-part body plan consisting of a _________.
    10·2 answers
  • A pathologist who wants to examine a patient's liver cells to determine if the mitochondria have an internal structural defect w
    7·1 answer
  • Unfortunately, you go a bit overboard and feel a sudden pinch, after which you notice you are bleeding. What has happened? Are y
    7·2 answers
  • The difference between the levels of ocean water at high and low tide is called
    14·1 answer
  • On what basis have biologists determined that Archaea and Bacteria are not closely related?
    12·1 answer
  • Graphs can be used to<br> a. Infer<br> b. Predict<br> c. Compare<br> d. All of the above
    7·1 answer
  • A key should be parallel. An example of parallel choices is _____
    7·1 answer
  • Explain what processes are going on in the picture? What do the numbers 1 and 2 mean?​
    6·1 answer
  • Muscles that produce movement in a single direction are
    11·1 answer
  • Enzymes<br> How do catalyst enzymes affect chemical reactions?<br> Your answer
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!