1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
3 years ago
8

During the first step of cellular respiration, glucose is converted into?

Biology
2 answers:
topjm [15]3 years ago
3 0

thats not the answer at all. the actual answer is pyruvate. Got me waisting my time on this and its the wrong answer, everyone makes mistakes and I am not mad, just devestated.

True [87]3 years ago
3 0

Answer:

The answer is pyruvate

Explanation:

It is because after glucose is broken down to a two 3 carbon-molecule it is also know as pyruvate.

You might be interested in
What are the chemical properties of gold
steposvetlana [31]

Answer:

Gold is soft metal, hard metal, malleable, and ductile.

Explanation:

5 0
3 years ago
The action potential can move only in one direction because the recently depolarized area of the membrane is an absolute refract
Nataly [62]

Answer: Na+ channels are closed

Explanation:

The refractory period describes a period between the initiation of an action potential (where Na+ channels are active/open), and immediately after the action potential’s peak.  In the absolute refractory period, action potentials cannot be generated, as Na+ channels are in an inactive or closed state, they usually take around one or two minutes.  

After the absolute refractory period the relative refractory period (RRP) occurs. During the RRP, it is hard to send another action potential. Na+ channels are once again open, but the cell remains hyperpolarized-  its membrane potential, remains negative. Recovery from inactivation is voltage and time-dependent; Action potentials would require an influx of more positively charged ions. These must be more than a specific threshold in order to have the cells send along more action potentials which helps with figuring out stimulus intensity.

3 0
3 years ago
What are the chemical products of cellular respiration?
KIM [24]

Answer:

Oxygen and glucose are both reactants in the <u>Process</u> of cellular respiration.

ATP is the main Product  formed in cellular respiration, and waste products include carbon dioxide and water.

Hope this helps!!

6 0
3 years ago
Which of the following has the greatest effect
almond37 [142]

Answer:

B.

Explanation:

In general the higher the percentage of slit and clay sized particles the higher the water holding capacity.

5 0
3 years ago
Read 2 more answers
Series of choices between two characteristics that is used to identify organisms is called a
irga5000 [103]

Answer:

Dichotomous key consist of series of choice associated with questions one after the other which helps in identifying an organism

Explanation:

Hope this helps :)

8 0
3 years ago
Read 2 more answers
Other questions:
  • How are metamorphic rocks part of the rock cycle?
    11·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What type of rock forms when preexisting rocks undergo changes in response to a modification of their environment, without first
    5·1 answer
  • a. Discuss one situation when you would use wormbase first? b. Discuss one situation when you would use OMIM first? c. Discuss o
    13·1 answer
  • WHAT IS the series of enzyme-mediated reactions that will reduce carbon dioxide into a carbohydrate.
    5·2 answers
  • Question 7
    8·2 answers
  • Name the two stages of photosynthesis and list the starting molecules and ending molecules of each.
    7·1 answer
  • Two types of cells are shown below. What molecules are sent to from Cell A
    5·1 answer
  • Which of the following is NOT basic information included in a crime scene report?
    13·1 answer
  • Components of the plasma membrane called ______ help form the glycocalyx.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!