1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bess [88]
3 years ago
8

Things in an experiment that may influence your data​

Biology
1 answer:
kobusy [5.1K]3 years ago
8 0

Answer:

1. Equipment

2. The Person

3. Method

4. Objects

5.  The environment

You might be interested in
Adding an organism to a food chain does not affect the other members of the food chain, but removing an organism does.
erica [24]
False. Both adding and taking away an organism affects a food chain.
7 0
3 years ago
explain why acid rain, smog, ocean acidification, and global warming are indirect results of air pollution.
Paraphin [41]
Well if we have no oxygen we cant breathe 
6 0
3 years ago
Read 2 more answers
Surface skin cells regenerate from stem cells found in which specific region?
vagabundo [1.1K]

Answer:

In the stratum basale.

Explanation:

The stratum basale is the deepest layer of the epidermis and the location of highly mitotic cells.

6 0
2 years ago
Guide Questions:
KengaRu [80]

Answer:

Egg white and amino acid solution.

Explanation:

Egg white and amino acid solution are the two foods that are used for building of body parts because they have proteins in them that is responsible for the building of muscles of in human body. There are two components of egg i.e. white and yellow part. White is the proteinic part whereas yellow parts having fats and other nutrients. Amino acid solution has amino acids which is considered as the building block from which protein is made.

3 0
2 years ago
During primary growth, the primary xylem and phloem grow alongside each other, except for a layer of tissue in between them. The
DanielleElmas [232]

Answer: Determinate growth

Explanation:

determinate growth stops when a plant element (such as a leaf) reaches a particular size.

6 0
3 years ago
Other questions:
  • "in june 2011, first lady michelle obama and the usda unveiled the federal government's new food icon, myplate, to help consumer
    7·1 answer
  • Compare surface, subsurface, and placer mining in terms of damage to the environment.
    13·2 answers
  • Which of the following statements is true about mitochondria?
    15·1 answer
  • How to Define life ?​
    12·2 answers
  • 4. What effect does light have on plant growth?
    7·1 answer
  • El oxido de cloro (cio), que tiene un efecto importante en la disminucion de la capa de ozono, se descompone rapida mente a temp
    9·1 answer
  • Please help me to answer this questions. If you help me to answer it I will give you brainiest​
    6·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Is the term that describes all the chemical reactions that occur in a cell, including the building of molecules and breaking dow
    11·1 answer
  • 7 Infer Before scientists were able an to view and study the ocean floor directly , why might they have expected the ocean floor
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!